Incidental Mutation 'R4928:Cdh3'
ID381012
Institutional Source Beutler Lab
Gene Symbol Cdh3
Ensembl Gene ENSMUSG00000061048
Gene Namecadherin 3
SynonymsPcad, P-cadherin, Cadp
MMRRC Submission 042529-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R4928 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106510891-106557297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 106536610 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 97 (R97L)
Ref Sequence ENSEMBL: ENSMUSP00000079613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080797]
PDB Structure Crystal structure of mouse P-cadherin extracellular domains EC1-EC2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000080797
AA Change: R97L

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079613
Gene: ENSMUSG00000061048
AA Change: R97L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 122 205 7.57e-11 SMART
CA 229 318 1.68e-26 SMART
CA 341 431 4.21e-18 SMART
CA 454 538 1.28e-22 SMART
Pfam:Cadherin_C 673 818 3.9e-46 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: This gene encodes a calcium-dependent cell-cell adhesion protein containing five cadherin domains. The encoded protein plays a role in epithelial outgrowth, such as that which occurs during the development of hair follicles and limb buds. Loss of function of the related gene in humans results in ectodermal dysplasia, ectrodactyly, and macular dystrophy and congential hypotrichosis with juvenile macular dystrophy. This gene is located in the vicinity of similar cadherin genes on chromosome 8. The proprotein is further cleaved into a functional chain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutation of this gene results in precocious development of mammary glands in virgin 10-week old females. Aged virgin females (24 weeks) exhibit alveolar hyperplasia, ductal dysplasia, and extensive lymphocyte infiltration of the mammary glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 83,155,878 noncoding transcript Het
Aasdh T A 5: 76,896,688 K118N possibly damaging Het
Abca14 A T 7: 120,324,580 N1620I possibly damaging Het
Acap1 A T 11: 69,885,815 S149T possibly damaging Het
Adgre1 T A 17: 57,444,064 Y579* probably null Het
AI314180 A G 4: 58,827,073 V1020A probably damaging Het
Aifm3 T C 16: 17,500,432 probably benign Het
Aldh16a1 A G 7: 45,141,961 W107R probably damaging Het
Amer2 A T 14: 60,379,445 H363L possibly damaging Het
Arhgap10 A G 8: 77,426,328 probably null Het
Arhgef6 A T X: 57,234,878 D742E probably damaging Het
Astn2 A T 4: 65,729,407 N731K probably damaging Het
Atp1a2 T C 1: 172,278,387 T904A possibly damaging Het
Atr C T 9: 95,907,299 R1503W probably damaging Het
Chst2 C T 9: 95,406,006 V96I probably benign Het
Cit T A 5: 115,985,797 N1464K probably benign Het
Col17a1 A T 19: 47,670,458 probably null Het
Col4a3 G A 1: 82,710,977 probably benign Het
Copz1 T A 15: 103,291,330 S57R probably damaging Het
Cpped1 A T 16: 11,828,279 F227Y probably damaging Het
Cyp2j12 A T 4: 96,102,151 probably null Het
Dctn1 T A 6: 83,189,207 I195N possibly damaging Het
Dhrs7b A G 11: 60,851,925 I148V probably benign Het
Dnah17 T C 11: 118,027,433 D4096G probably damaging Het
Dnajc13 T C 9: 104,233,638 N145D possibly damaging Het
Ercc6l2 T C 13: 63,894,813 probably benign Het
Fads6 T G 11: 115,296,561 I103L probably benign Het
Fam189a1 G T 7: 64,759,368 S426* probably null Het
Fat4 T G 3: 39,010,465 Y4857D probably damaging Het
Fbxl14 T A 6: 119,480,710 L284Q probably damaging Het
Fkbp9 T C 6: 56,849,670 V85A possibly damaging Het
Galnt13 T A 2: 54,516,565 V9E probably damaging Het
Gm14412 A T 2: 177,314,580 S507R probably benign Het
Gm15142 T A X: 154,638,419 noncoding transcript Het
Gm4787 T C 12: 81,378,838 E182G probably benign Het
Gm6811 C A 17: 21,094,631 noncoding transcript Het
Gm9791 A T 3: 34,005,069 noncoding transcript Het
Hoxb7 A T 11: 96,289,510 probably null Het
Ift122 T A 6: 115,915,858 probably benign Het
Krt28 C T 11: 99,374,632 V70I probably benign Het
Lig1 T C 7: 13,298,738 S459P probably damaging Het
Lrfn3 C T 7: 30,360,623 R59H possibly damaging Het
Mavs T C 2: 131,246,743 V489A probably benign Het
Mcm8 C T 2: 132,839,479 P625L probably benign Het
Megf10 G T 18: 57,240,673 R181L probably benign Het
Mgrn1 G A 16: 4,927,862 G440D probably benign Het
Mllt3 T C 4: 87,782,405 probably null Het
Muc5ac T A 7: 141,817,902 Y2613* probably null Het
Myh14 C T 7: 44,635,502 G662S probably benign Het
Myod1 T A 7: 46,377,050 N126K probably damaging Het
Nae1 A T 8: 104,516,142 H439Q possibly damaging Het
Narf T A 11: 121,244,939 V136E possibly damaging Het
Ncapd3 T A 9: 27,071,735 C926* probably null Het
Ndufv2 C A 17: 66,092,658 probably null Het
Neb T C 2: 52,212,975 S449G possibly damaging Het
Nek10 C T 14: 14,930,577 P698L probably damaging Het
Nox3 T A 17: 3,635,275 E566V probably null Het
Oas1a C T 5: 120,905,724 R115H probably benign Het
Olfr1076 T A 2: 86,509,125 L222H probably damaging Het
Olfr1130 C A 2: 87,608,143 L252I probably benign Het
Olfr1152 A G 2: 87,868,230 M80V probably benign Het
Olfr65 A G 7: 103,906,672 T78A probably damaging Het
Pbld2 A G 10: 63,047,999 H142R probably damaging Het
Pcdha4 C T 18: 36,954,816 T684M probably benign Het
Phc3 G T 3: 30,950,919 T175N probably damaging Het
Pigs G T 11: 78,329,002 V68L probably damaging Het
Pik3c2g T A 6: 139,967,802 D857E possibly damaging Het
Pitpnm3 G A 11: 72,063,172 P550S probably damaging Het
Pla2g15 G A 8: 106,163,218 W374* probably null Het
Ptpn14 G A 1: 189,822,642 C133Y probably damaging Het
Ptpn20 A G 14: 33,614,489 N95S probably benign Het
Ptrh2 G T 11: 86,690,036 V160F probably damaging Het
Rapgef3 T C 15: 97,757,375 D486G probably damaging Het
Rev3l T G 10: 39,823,985 S1493A probably benign Het
Rgs9 T A 11: 109,225,744 D411V probably benign Het
Rgsl1 A T 1: 153,793,768 Y291N probably damaging Het
Rprd2 A G 3: 95,764,537 Y1185H probably damaging Het
Rpusd3 A G 6: 113,416,206 probably benign Het
Scnn1a T C 6: 125,322,173 I72T probably damaging Het
Sdk1 A T 5: 141,857,003 probably benign Het
Sfmbt2 T C 2: 10,445,745 L277P probably benign Het
Sgf29 A G 7: 126,664,982 E73G probably damaging Het
Slc12a6 T A 2: 112,352,961 F764L probably damaging Het
Slc4a2 T C 5: 24,435,342 probably null Het
Slc9a3 T G 13: 74,157,719 V285G probably damaging Het
Slc9c1 A G 16: 45,575,409 T608A probably benign Het
Slfnl1 C T 4: 120,535,685 R325C probably damaging Het
Smarcad1 T A 6: 65,074,914 F344I probably benign Het
Snrnp70 A T 7: 45,377,281 probably null Het
Sod2 C T 17: 13,008,186 T9M probably benign Het
Spag5 T A 11: 78,314,373 S633T probably damaging Het
Spta1 A T 1: 174,191,056 I531L probably benign Het
Stra8 A G 6: 34,933,156 E60G probably benign Het
Sult2a3 T A 7: 14,111,557 I126F probably benign Het
Syt1 T C 10: 108,504,512 H315R possibly damaging Het
Tanc2 T C 11: 105,867,762 L783P probably damaging Het
Thbs2 C T 17: 14,678,900 C646Y probably damaging Het
Ticam2 T A 18: 46,560,922 K33* probably null Het
Trim17 T C 11: 58,954,301 probably benign Het
Tsr1 G A 11: 74,907,879 M691I probably benign Het
Ttn T A 2: 76,762,419 I20790F probably damaging Het
Tubb2b A T 13: 34,128,185 Y208* probably null Het
Ubr1 T A 2: 120,914,938 I890F probably damaging Het
Usp54 T C 14: 20,562,192 E852G probably damaging Het
Vmn2r78 T C 7: 86,954,627 V671A probably damaging Het
Wipi1 T C 11: 109,579,649 K315E probably benign Het
Xrn2 T C 2: 147,051,718 V735A possibly damaging Het
Zdbf2 T A 1: 63,308,814 D2117E possibly damaging Het
Zfp287 A T 11: 62,714,136 C648* probably null Het
Zfp369 A G 13: 65,296,800 T586A possibly damaging Het
Other mutations in Cdh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Cdh3 APN 8 106555305 missense probably damaging 1.00
IGL01431:Cdh3 APN 8 106547669 missense probably damaging 1.00
IGL01466:Cdh3 APN 8 106536595 missense possibly damaging 0.62
IGL01794:Cdh3 APN 8 106537126 missense possibly damaging 0.78
IGL02100:Cdh3 APN 8 106543690 missense probably benign
IGL02272:Cdh3 APN 8 106547836 splice site probably null
IGL02292:Cdh3 APN 8 106545201 missense probably damaging 0.99
IGL02553:Cdh3 APN 8 106544248 nonsense probably null
IGL03245:Cdh3 APN 8 106552999 missense probably damaging 1.00
IGL03376:Cdh3 APN 8 106541404 missense probably benign 0.01
Arctus UTSW 8 106539856 missense probably damaging 1.00
R4778_Cdh3_090 UTSW 8 106543826 missense probably damaging 0.98
R7512_Cdh3_158 UTSW 8 106539008 nonsense probably null
PIT4486001:Cdh3 UTSW 8 106541490 missense possibly damaging 0.89
R0143:Cdh3 UTSW 8 106511225 missense probably benign 0.35
R0388:Cdh3 UTSW 8 106539129 missense probably damaging 1.00
R0462:Cdh3 UTSW 8 106555380 missense possibly damaging 0.65
R0526:Cdh3 UTSW 8 106555446 missense possibly damaging 0.69
R0788:Cdh3 UTSW 8 106541415 missense probably benign 0.05
R1495:Cdh3 UTSW 8 106538997 missense probably damaging 1.00
R1653:Cdh3 UTSW 8 106539068 missense probably damaging 1.00
R1806:Cdh3 UTSW 8 106536915 missense probably benign 0.02
R2124:Cdh3 UTSW 8 106552888 missense probably damaging 1.00
R2302:Cdh3 UTSW 8 106545069 missense probably damaging 1.00
R2326:Cdh3 UTSW 8 106511308 missense probably benign
R2508:Cdh3 UTSW 8 106552407 missense probably damaging 1.00
R3625:Cdh3 UTSW 8 106543678 missense probably damaging 0.98
R3767:Cdh3 UTSW 8 106536974 splice site probably null
R4679:Cdh3 UTSW 8 106539856 missense probably damaging 1.00
R4716:Cdh3 UTSW 8 106543888 missense probably benign
R4778:Cdh3 UTSW 8 106543826 missense probably damaging 0.98
R5069:Cdh3 UTSW 8 106536826 missense probably benign 0.19
R5101:Cdh3 UTSW 8 106541392 missense possibly damaging 0.60
R5204:Cdh3 UTSW 8 106544239 missense probably benign 0.29
R5309:Cdh3 UTSW 8 106539020 missense probably damaging 0.98
R5343:Cdh3 UTSW 8 106552936 missense probably benign
R5408:Cdh3 UTSW 8 106536637 missense probably damaging 0.98
R6253:Cdh3 UTSW 8 106537063 splice site probably null
R6637:Cdh3 UTSW 8 106511341 missense probably benign
R6639:Cdh3 UTSW 8 106511341 missense probably benign
R7142:Cdh3 UTSW 8 106545228 critical splice donor site probably null
R7371:Cdh3 UTSW 8 106552477 missense probably damaging 1.00
R7397:Cdh3 UTSW 8 106536609 nonsense probably null
R7458:Cdh3 UTSW 8 106537147 missense probably damaging 1.00
R7512:Cdh3 UTSW 8 106539008 nonsense probably null
R7522:Cdh3 UTSW 8 106541373 missense probably damaging 1.00
R7586:Cdh3 UTSW 8 106511343 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCCATTCCTCCTGAGAAG -3'
(R):5'- AAATCTTGGTGCCTCTGTCC -3'

Sequencing Primer
(F):5'- GGCTGGCCTCAAATTGCTACATAG -3'
(R):5'- GTCCTTATTAGATTTGAGCTGGAAAC -3'
Posted On2016-04-15