Incidental Mutation 'R4928:Rev3l'
ID381018
Institutional Source Beutler Lab
Gene Symbol Rev3l
Ensembl Gene ENSMUSG00000019841
Gene NameREV3 like, DNA directed polymerase zeta catalytic subunit
SynonymsSez4, Rev
MMRRC Submission 042529-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4928 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location39732118-39875211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 39823985 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 1493 (S1493A)
Ref Sequence ENSEMBL: ENSMUSP00000131519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]
Predicted Effect probably benign
Transcript: ENSMUST00000019986
AA Change: S1493A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: S1493A

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 201 1.6e-10 PFAM
low complexity region 494 506 N/A INTRINSIC
low complexity region 959 969 N/A INTRINSIC
low complexity region 1042 1057 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3103 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131186
Predicted Effect probably benign
Transcript: ENSMUST00000139803
SMART Domains Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

DomainStartEndE-ValueType
Blast:POLBc 1 369 1e-155 BLAST
POLBc 434 805 4.77e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145333
Predicted Effect probably benign
Transcript: ENSMUST00000164763
AA Change: S1493A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: S1493A

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 200 1.3e-11 PFAM
low complexity region 494 506 N/A INTRINSIC
Pfam:DUF4683 745 1132 1.7e-162 PFAM
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3102 6.1e-15 PFAM
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 83,155,878 noncoding transcript Het
Aasdh T A 5: 76,896,688 K118N possibly damaging Het
Abca14 A T 7: 120,324,580 N1620I possibly damaging Het
Acap1 A T 11: 69,885,815 S149T possibly damaging Het
Adgre1 T A 17: 57,444,064 Y579* probably null Het
AI314180 A G 4: 58,827,073 V1020A probably damaging Het
Aifm3 T C 16: 17,500,432 probably benign Het
Aldh16a1 A G 7: 45,141,961 W107R probably damaging Het
Amer2 A T 14: 60,379,445 H363L possibly damaging Het
Arhgap10 A G 8: 77,426,328 probably null Het
Arhgef6 A T X: 57,234,878 D742E probably damaging Het
Astn2 A T 4: 65,729,407 N731K probably damaging Het
Atp1a2 T C 1: 172,278,387 T904A possibly damaging Het
Atr C T 9: 95,907,299 R1503W probably damaging Het
Cdh3 G T 8: 106,536,610 R97L probably benign Het
Chst2 C T 9: 95,406,006 V96I probably benign Het
Cit T A 5: 115,985,797 N1464K probably benign Het
Col17a1 A T 19: 47,670,458 probably null Het
Col4a3 G A 1: 82,710,977 probably benign Het
Copz1 T A 15: 103,291,330 S57R probably damaging Het
Cpped1 A T 16: 11,828,279 F227Y probably damaging Het
Cyp2j12 A T 4: 96,102,151 probably null Het
Dctn1 T A 6: 83,189,207 I195N possibly damaging Het
Dhrs7b A G 11: 60,851,925 I148V probably benign Het
Dnah17 T C 11: 118,027,433 D4096G probably damaging Het
Dnajc13 T C 9: 104,233,638 N145D possibly damaging Het
Ercc6l2 T C 13: 63,894,813 probably benign Het
Fads6 T G 11: 115,296,561 I103L probably benign Het
Fam189a1 G T 7: 64,759,368 S426* probably null Het
Fat4 T G 3: 39,010,465 Y4857D probably damaging Het
Fbxl14 T A 6: 119,480,710 L284Q probably damaging Het
Fkbp9 T C 6: 56,849,670 V85A possibly damaging Het
Galnt13 T A 2: 54,516,565 V9E probably damaging Het
Gm14412 A T 2: 177,314,580 S507R probably benign Het
Gm15142 T A X: 154,638,419 noncoding transcript Het
Gm4787 T C 12: 81,378,838 E182G probably benign Het
Gm6811 C A 17: 21,094,631 noncoding transcript Het
Gm9791 A T 3: 34,005,069 noncoding transcript Het
Hoxb7 A T 11: 96,289,510 probably null Het
Ift122 T A 6: 115,915,858 probably benign Het
Krt28 C T 11: 99,374,632 V70I probably benign Het
Lig1 T C 7: 13,298,738 S459P probably damaging Het
Lrfn3 C T 7: 30,360,623 R59H possibly damaging Het
Mavs T C 2: 131,246,743 V489A probably benign Het
Mcm8 C T 2: 132,839,479 P625L probably benign Het
Megf10 G T 18: 57,240,673 R181L probably benign Het
Mgrn1 G A 16: 4,927,862 G440D probably benign Het
Mllt3 T C 4: 87,782,405 probably null Het
Muc5ac T A 7: 141,817,902 Y2613* probably null Het
Myh14 C T 7: 44,635,502 G662S probably benign Het
Myod1 T A 7: 46,377,050 N126K probably damaging Het
Nae1 A T 8: 104,516,142 H439Q possibly damaging Het
Narf T A 11: 121,244,939 V136E possibly damaging Het
Ncapd3 T A 9: 27,071,735 C926* probably null Het
Ndufv2 C A 17: 66,092,658 probably null Het
Neb T C 2: 52,212,975 S449G possibly damaging Het
Nek10 C T 14: 14,930,577 P698L probably damaging Het
Nox3 T A 17: 3,635,275 E566V probably null Het
Oas1a C T 5: 120,905,724 R115H probably benign Het
Olfr1076 T A 2: 86,509,125 L222H probably damaging Het
Olfr1130 C A 2: 87,608,143 L252I probably benign Het
Olfr1152 A G 2: 87,868,230 M80V probably benign Het
Olfr65 A G 7: 103,906,672 T78A probably damaging Het
Pbld2 A G 10: 63,047,999 H142R probably damaging Het
Pcdha4 C T 18: 36,954,816 T684M probably benign Het
Phc3 G T 3: 30,950,919 T175N probably damaging Het
Pigs G T 11: 78,329,002 V68L probably damaging Het
Pik3c2g T A 6: 139,967,802 D857E possibly damaging Het
Pitpnm3 G A 11: 72,063,172 P550S probably damaging Het
Pla2g15 G A 8: 106,163,218 W374* probably null Het
Ptpn14 G A 1: 189,822,642 C133Y probably damaging Het
Ptpn20 A G 14: 33,614,489 N95S probably benign Het
Ptrh2 G T 11: 86,690,036 V160F probably damaging Het
Rapgef3 T C 15: 97,757,375 D486G probably damaging Het
Rgs9 T A 11: 109,225,744 D411V probably benign Het
Rgsl1 A T 1: 153,793,768 Y291N probably damaging Het
Rprd2 A G 3: 95,764,537 Y1185H probably damaging Het
Rpusd3 A G 6: 113,416,206 probably benign Het
Scnn1a T C 6: 125,322,173 I72T probably damaging Het
Sdk1 A T 5: 141,857,003 probably benign Het
Sfmbt2 T C 2: 10,445,745 L277P probably benign Het
Sgf29 A G 7: 126,664,982 E73G probably damaging Het
Slc12a6 T A 2: 112,352,961 F764L probably damaging Het
Slc4a2 T C 5: 24,435,342 probably null Het
Slc9a3 T G 13: 74,157,719 V285G probably damaging Het
Slc9c1 A G 16: 45,575,409 T608A probably benign Het
Slfnl1 C T 4: 120,535,685 R325C probably damaging Het
Smarcad1 T A 6: 65,074,914 F344I probably benign Het
Snrnp70 A T 7: 45,377,281 probably null Het
Sod2 C T 17: 13,008,186 T9M probably benign Het
Spag5 T A 11: 78,314,373 S633T probably damaging Het
Spta1 A T 1: 174,191,056 I531L probably benign Het
Stra8 A G 6: 34,933,156 E60G probably benign Het
Sult2a3 T A 7: 14,111,557 I126F probably benign Het
Syt1 T C 10: 108,504,512 H315R possibly damaging Het
Tanc2 T C 11: 105,867,762 L783P probably damaging Het
Thbs2 C T 17: 14,678,900 C646Y probably damaging Het
Ticam2 T A 18: 46,560,922 K33* probably null Het
Trim17 T C 11: 58,954,301 probably benign Het
Tsr1 G A 11: 74,907,879 M691I probably benign Het
Ttn T A 2: 76,762,419 I20790F probably damaging Het
Tubb2b A T 13: 34,128,185 Y208* probably null Het
Ubr1 T A 2: 120,914,938 I890F probably damaging Het
Usp54 T C 14: 20,562,192 E852G probably damaging Het
Vmn2r78 T C 7: 86,954,627 V671A probably damaging Het
Wipi1 T C 11: 109,579,649 K315E probably benign Het
Xrn2 T C 2: 147,051,718 V735A possibly damaging Het
Zdbf2 T A 1: 63,308,814 D2117E possibly damaging Het
Zfp287 A T 11: 62,714,136 C648* probably null Het
Zfp369 A G 13: 65,296,800 T586A possibly damaging Het
Other mutations in Rev3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Rev3l APN 10 39806969 missense probably benign
IGL00815:Rev3l APN 10 39859153 missense possibly damaging 0.79
IGL00964:Rev3l APN 10 39864806 missense probably benign 0.39
IGL01765:Rev3l APN 10 39828265 missense probably benign 0.00
IGL01792:Rev3l APN 10 39823340 missense probably benign
IGL01950:Rev3l APN 10 39821157 missense probably damaging 1.00
IGL01963:Rev3l APN 10 39822737 missense possibly damaging 0.90
IGL02089:Rev3l APN 10 39825099 missense probably damaging 1.00
IGL02288:Rev3l APN 10 39828216 missense probably benign
IGL02381:Rev3l APN 10 39821346 missense possibly damaging 0.83
IGL02409:Rev3l APN 10 39821148 missense possibly damaging 0.75
IGL02434:Rev3l APN 10 39822591 missense probably damaging 1.00
IGL02570:Rev3l APN 10 39848013 missense possibly damaging 0.68
IGL02581:Rev3l APN 10 39821281 missense probably benign 0.10
IGL02654:Rev3l APN 10 39862734 missense probably damaging 1.00
IGL02720:Rev3l APN 10 39822395 nonsense probably null
IGL02746:Rev3l APN 10 39824589 missense probably damaging 0.99
IGL02829:Rev3l APN 10 39825240 missense probably damaging 1.00
IGL02961:Rev3l APN 10 39827945 missense possibly damaging 0.65
IGL02974:Rev3l APN 10 39862747 nonsense probably null
IGL03029:Rev3l APN 10 39828486 missense probably benign 0.34
IGL03153:Rev3l APN 10 39806878 missense probably damaging 1.00
IGL03172:Rev3l APN 10 39824790 missense probably benign 0.10
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0153:Rev3l UTSW 10 39874128 nonsense probably null
R0308:Rev3l UTSW 10 39824894 missense probably benign 0.09
R0355:Rev3l UTSW 10 39817286 missense probably damaging 1.00
R0513:Rev3l UTSW 10 39828143 missense probably benign 0.00
R0523:Rev3l UTSW 10 39848049 missense probably benign 0.02
R0559:Rev3l UTSW 10 39824487 missense probably damaging 1.00
R0761:Rev3l UTSW 10 39874195 missense probably benign 0.32
R1023:Rev3l UTSW 10 39832639 missense probably damaging 1.00
R1159:Rev3l UTSW 10 39851925 nonsense probably null
R1398:Rev3l UTSW 10 39821583 missense probably benign 0.05
R1478:Rev3l UTSW 10 39783333 critical splice donor site probably null
R1517:Rev3l UTSW 10 39838443 missense probably benign 0.34
R1527:Rev3l UTSW 10 39822822 missense probably damaging 1.00
R1635:Rev3l UTSW 10 39806662 missense probably damaging 0.98
R1695:Rev3l UTSW 10 39824615 nonsense probably null
R1695:Rev3l UTSW 10 39824616 missense probably damaging 0.97
R1782:Rev3l UTSW 10 39799885 missense probably benign
R1815:Rev3l UTSW 10 39822871 missense probably benign 0.41
R1818:Rev3l UTSW 10 39828424 missense probably benign 0.05
R2039:Rev3l UTSW 10 39824444 missense probably damaging 1.00
R2071:Rev3l UTSW 10 39824353 missense probably benign 0.17
R2101:Rev3l UTSW 10 39828096 missense probably benign 0.00
R2141:Rev3l UTSW 10 39848049 missense probably benign 0.02
R2883:Rev3l UTSW 10 39825156 missense probably damaging 1.00
R3787:Rev3l UTSW 10 39846210 missense probably damaging 0.97
R3910:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3912:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3913:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R4590:Rev3l UTSW 10 39806933 missense probably damaging 1.00
R4631:Rev3l UTSW 10 39828416 missense probably benign 0.44
R4633:Rev3l UTSW 10 39846186 missense probably damaging 1.00
R4707:Rev3l UTSW 10 39823397 missense probably damaging 0.99
R4724:Rev3l UTSW 10 39846806 nonsense probably null
R4810:Rev3l UTSW 10 39823725 missense probably benign 0.01
R4857:Rev3l UTSW 10 39838459 missense probably damaging 1.00
R4882:Rev3l UTSW 10 39821460 missense possibly damaging 0.89
R4970:Rev3l UTSW 10 39823330 missense probably benign 0.00
R4977:Rev3l UTSW 10 39823578 missense possibly damaging 0.80
R5112:Rev3l UTSW 10 39823330 missense probably benign 0.00
R5261:Rev3l UTSW 10 39846729 missense probably damaging 1.00
R5419:Rev3l UTSW 10 39824931 missense possibly damaging 0.95
R5570:Rev3l UTSW 10 39852075 critical splice donor site probably null
R5628:Rev3l UTSW 10 39822967 missense probably damaging 0.98
R5689:Rev3l UTSW 10 39794958 missense probably damaging 1.00
R5781:Rev3l UTSW 10 39823093 missense probably benign 0.00
R5829:Rev3l UTSW 10 39806906 missense probably damaging 0.97
R5984:Rev3l UTSW 10 39742689 intron probably benign
R5990:Rev3l UTSW 10 39823811 missense probably benign 0.17
R6054:Rev3l UTSW 10 39824150 missense probably benign 0.01
R6171:Rev3l UTSW 10 39862713 nonsense probably null
R6220:Rev3l UTSW 10 39822779 missense probably damaging 1.00
R6520:Rev3l UTSW 10 39822702 missense probably benign 0.06
R6798:Rev3l UTSW 10 39854763 missense probably damaging 1.00
R6811:Rev3l UTSW 10 39830921 nonsense probably null
R6812:Rev3l UTSW 10 39823548 missense probably benign
R6904:Rev3l UTSW 10 39821481 missense probably benign
R6905:Rev3l UTSW 10 39817327 missense probably benign 0.18
R6938:Rev3l UTSW 10 39862710 missense probably damaging 1.00
R7037:Rev3l UTSW 10 39851975 missense probably damaging 1.00
R7124:Rev3l UTSW 10 39822167 nonsense probably null
R7286:Rev3l UTSW 10 39823605 missense probably damaging 0.99
R7385:Rev3l UTSW 10 39823682 missense probably benign 0.01
R7575:Rev3l UTSW 10 39821445 missense possibly damaging 0.56
R7596:Rev3l UTSW 10 39821538 missense probably damaging 1.00
R7597:Rev3l UTSW 10 39822884 missense probably damaging 1.00
R7670:Rev3l UTSW 10 39836722 missense probably benign 0.01
R7804:Rev3l UTSW 10 39823485 missense probably benign 0.34
R7818:Rev3l UTSW 10 39823902 missense possibly damaging 0.54
R7874:Rev3l UTSW 10 39822495 missense possibly damaging 0.72
R7957:Rev3l UTSW 10 39822495 missense possibly damaging 0.72
R8059:Rev3l UTSW 10 39843495 missense probably damaging 1.00
X0022:Rev3l UTSW 10 39828607 critical splice donor site probably null
Z1088:Rev3l UTSW 10 39824318 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CTGCAAAGACAGTCAGCAGC -3'
(R):5'- TCTTATCTGGCTGATGAGTAGACG -3'

Sequencing Primer
(F):5'- CTGTGAGTGTGTCAGAACAATC -3'
(R):5'- CGTTGAGTCTTGTACGACATTTGTAC -3'
Posted On2016-04-15