Incidental Mutation 'R4928:Rev3l'
ID 381018
Institutional Source Beutler Lab
Gene Symbol Rev3l
Ensembl Gene ENSMUSG00000019841
Gene Name REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms Sez4, Rev
MMRRC Submission 042529-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4928 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 39608114-39751207 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 39699981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 1493 (S1493A)
Ref Sequence ENSEMBL: ENSMUSP00000131519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019986
AA Change: S1493A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: S1493A

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 201 1.6e-10 PFAM
low complexity region 494 506 N/A INTRINSIC
low complexity region 959 969 N/A INTRINSIC
low complexity region 1042 1057 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3103 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131186
Predicted Effect probably benign
Transcript: ENSMUST00000139803
SMART Domains Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

DomainStartEndE-ValueType
Blast:POLBc 1 369 1e-155 BLAST
POLBc 434 805 4.77e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145333
Predicted Effect probably benign
Transcript: ENSMUST00000164763
AA Change: S1493A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: S1493A

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 200 1.3e-11 PFAM
low complexity region 494 506 N/A INTRINSIC
Pfam:DUF4683 745 1132 1.7e-162 PFAM
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3102 6.1e-15 PFAM
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 82,805,086 (GRCm39) noncoding transcript Het
Aasdh T A 5: 77,044,535 (GRCm39) K118N possibly damaging Het
Abca14 A T 7: 119,923,803 (GRCm39) N1620I possibly damaging Het
Acap1 A T 11: 69,776,641 (GRCm39) S149T possibly damaging Het
Adgre1 T A 17: 57,751,064 (GRCm39) Y579* probably null Het
Aifm3 T C 16: 17,318,296 (GRCm39) probably benign Het
Aldh16a1 A G 7: 44,791,385 (GRCm39) W107R probably damaging Het
Amer2 A T 14: 60,616,894 (GRCm39) H363L possibly damaging Het
Arhgap10 A G 8: 78,152,957 (GRCm39) probably null Het
Arhgef6 A T X: 56,280,238 (GRCm39) D742E probably damaging Het
Astn2 A T 4: 65,647,644 (GRCm39) N731K probably damaging Het
Atp1a2 T C 1: 172,105,954 (GRCm39) T904A possibly damaging Het
Atr C T 9: 95,789,352 (GRCm39) R1503W probably damaging Het
Cdh3 G T 8: 107,263,242 (GRCm39) R97L probably benign Het
Chst2 C T 9: 95,288,059 (GRCm39) V96I probably benign Het
Cit T A 5: 116,123,856 (GRCm39) N1464K probably benign Het
Col17a1 A T 19: 47,658,897 (GRCm39) probably null Het
Col4a3 G A 1: 82,688,698 (GRCm39) probably benign Het
Copz1 T A 15: 103,199,757 (GRCm39) S57R probably damaging Het
Cpped1 A T 16: 11,646,143 (GRCm39) F227Y probably damaging Het
Cyp2j12 A T 4: 95,990,388 (GRCm39) probably null Het
Dctn1 T A 6: 83,166,189 (GRCm39) I195N possibly damaging Het
Dhrs7b A G 11: 60,742,751 (GRCm39) I148V probably benign Het
Dnah17 T C 11: 117,918,259 (GRCm39) D4096G probably damaging Het
Dnajc13 T C 9: 104,110,837 (GRCm39) N145D possibly damaging Het
Ecpas A G 4: 58,827,073 (GRCm39) V1020A probably damaging Het
Entrep2 G T 7: 64,409,116 (GRCm39) S426* probably null Het
Ercc6l2 T C 13: 64,042,627 (GRCm39) probably benign Het
Fads6 T G 11: 115,187,387 (GRCm39) I103L probably benign Het
Fat4 T G 3: 39,064,614 (GRCm39) Y4857D probably damaging Het
Fbxl14 T A 6: 119,457,671 (GRCm39) L284Q probably damaging Het
Fkbp9 T C 6: 56,826,655 (GRCm39) V85A possibly damaging Het
Galnt13 T A 2: 54,406,577 (GRCm39) V9E probably damaging Het
Gm14412 A T 2: 177,006,373 (GRCm39) S507R probably benign Het
Gm15142 T A X: 153,421,415 (GRCm39) noncoding transcript Het
Gm4787 T C 12: 81,425,612 (GRCm39) E182G probably benign Het
Gm6811 C A 17: 21,314,893 (GRCm39) noncoding transcript Het
Gm9791 A T 3: 34,059,218 (GRCm39) noncoding transcript Het
Hoxb7 A T 11: 96,180,336 (GRCm39) probably null Het
Ift122 T A 6: 115,892,819 (GRCm39) probably benign Het
Krt28 C T 11: 99,265,458 (GRCm39) V70I probably benign Het
Lig1 T C 7: 13,032,664 (GRCm39) S459P probably damaging Het
Lrfn3 C T 7: 30,060,048 (GRCm39) R59H possibly damaging Het
Mavs T C 2: 131,088,663 (GRCm39) V489A probably benign Het
Mcm8 C T 2: 132,681,399 (GRCm39) P625L probably benign Het
Megf10 G T 18: 57,373,745 (GRCm39) R181L probably benign Het
Mgrn1 G A 16: 4,745,726 (GRCm39) G440D probably benign Het
Mllt3 T C 4: 87,700,642 (GRCm39) probably null Het
Muc5ac T A 7: 141,371,639 (GRCm39) Y2613* probably null Het
Myh14 C T 7: 44,284,926 (GRCm39) G662S probably benign Het
Myod1 T A 7: 46,026,474 (GRCm39) N126K probably damaging Het
Nae1 A T 8: 105,242,774 (GRCm39) H439Q possibly damaging Het
Narf T A 11: 121,135,765 (GRCm39) V136E possibly damaging Het
Ncapd3 T A 9: 26,983,031 (GRCm39) C926* probably null Het
Ndufv2 C A 17: 66,399,653 (GRCm39) probably null Het
Neb T C 2: 52,102,987 (GRCm39) S449G possibly damaging Het
Nek10 C T 14: 14,930,577 (GRCm38) P698L probably damaging Het
Nox3 T A 17: 3,685,550 (GRCm39) E566V probably null Het
Oas1a C T 5: 121,043,787 (GRCm39) R115H probably benign Het
Or10ag60 C A 2: 87,438,487 (GRCm39) L252I probably benign Het
Or51b6 A G 7: 103,555,879 (GRCm39) T78A probably damaging Het
Or5w19 A G 2: 87,698,574 (GRCm39) M80V probably benign Het
Or8k30 T A 2: 86,339,469 (GRCm39) L222H probably damaging Het
Pbld2 A G 10: 62,883,778 (GRCm39) H142R probably damaging Het
Pcdha4 C T 18: 37,087,869 (GRCm39) T684M probably benign Het
Phc3 G T 3: 31,005,068 (GRCm39) T175N probably damaging Het
Pigs G T 11: 78,219,828 (GRCm39) V68L probably damaging Het
Pik3c2g T A 6: 139,913,528 (GRCm39) D857E possibly damaging Het
Pitpnm3 G A 11: 71,953,998 (GRCm39) P550S probably damaging Het
Pla2g15 G A 8: 106,889,850 (GRCm39) W374* probably null Het
Ptpn14 G A 1: 189,554,839 (GRCm39) C133Y probably damaging Het
Ptpn20 A G 14: 33,336,446 (GRCm39) N95S probably benign Het
Ptrh2 G T 11: 86,580,862 (GRCm39) V160F probably damaging Het
Rapgef3 T C 15: 97,655,256 (GRCm39) D486G probably damaging Het
Rgs9 T A 11: 109,116,570 (GRCm39) D411V probably benign Het
Rgsl1 A T 1: 153,669,514 (GRCm39) Y291N probably damaging Het
Rprd2 A G 3: 95,671,849 (GRCm39) Y1185H probably damaging Het
Rpusd3 A G 6: 113,393,167 (GRCm39) probably benign Het
Scnn1a T C 6: 125,299,136 (GRCm39) I72T probably damaging Het
Sdk1 A T 5: 141,842,758 (GRCm39) probably benign Het
Sfmbt2 T C 2: 10,450,556 (GRCm39) L277P probably benign Het
Sgf29 A G 7: 126,264,154 (GRCm39) E73G probably damaging Het
Slc12a6 T A 2: 112,183,306 (GRCm39) F764L probably damaging Het
Slc4a2 T C 5: 24,640,340 (GRCm39) probably null Het
Slc9a3 T G 13: 74,305,838 (GRCm39) V285G probably damaging Het
Slc9c1 A G 16: 45,395,772 (GRCm39) T608A probably benign Het
Slfnl1 C T 4: 120,392,882 (GRCm39) R325C probably damaging Het
Smarcad1 T A 6: 65,051,898 (GRCm39) F344I probably benign Het
Snrnp70 A T 7: 45,026,705 (GRCm39) probably null Het
Sod2 C T 17: 13,227,073 (GRCm39) T9M probably benign Het
Spag5 T A 11: 78,205,199 (GRCm39) S633T probably damaging Het
Spta1 A T 1: 174,018,622 (GRCm39) I531L probably benign Het
Stra8 A G 6: 34,910,091 (GRCm39) E60G probably benign Het
Sult2a3 T A 7: 13,845,482 (GRCm39) I126F probably benign Het
Syt1 T C 10: 108,340,373 (GRCm39) H315R possibly damaging Het
Tanc2 T C 11: 105,758,588 (GRCm39) L783P probably damaging Het
Thbs2 C T 17: 14,899,162 (GRCm39) C646Y probably damaging Het
Ticam2 T A 18: 46,693,989 (GRCm39) K33* probably null Het
Trim17 T C 11: 58,845,127 (GRCm39) probably benign Het
Tsr1 G A 11: 74,798,705 (GRCm39) M691I probably benign Het
Ttn T A 2: 76,592,763 (GRCm39) I20790F probably damaging Het
Tubb2b A T 13: 34,312,168 (GRCm39) Y208* probably null Het
Ubr1 T A 2: 120,745,419 (GRCm39) I890F probably damaging Het
Usp54 T C 14: 20,612,260 (GRCm39) E852G probably damaging Het
Vmn2r78 T C 7: 86,603,835 (GRCm39) V671A probably damaging Het
Wipi1 T C 11: 109,470,475 (GRCm39) K315E probably benign Het
Xrn2 T C 2: 146,893,638 (GRCm39) V735A possibly damaging Het
Zdbf2 T A 1: 63,347,973 (GRCm39) D2117E possibly damaging Het
Zfp287 A T 11: 62,604,962 (GRCm39) C648* probably null Het
Zfp369 A G 13: 65,444,614 (GRCm39) T586A possibly damaging Het
Other mutations in Rev3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Rev3l APN 10 39,682,965 (GRCm39) missense probably benign
IGL00815:Rev3l APN 10 39,735,149 (GRCm39) missense possibly damaging 0.79
IGL00964:Rev3l APN 10 39,740,802 (GRCm39) missense probably benign 0.39
IGL01765:Rev3l APN 10 39,704,261 (GRCm39) missense probably benign 0.00
IGL01792:Rev3l APN 10 39,699,336 (GRCm39) missense probably benign
IGL01950:Rev3l APN 10 39,697,153 (GRCm39) missense probably damaging 1.00
IGL01963:Rev3l APN 10 39,698,733 (GRCm39) missense possibly damaging 0.90
IGL02089:Rev3l APN 10 39,701,095 (GRCm39) missense probably damaging 1.00
IGL02288:Rev3l APN 10 39,704,212 (GRCm39) missense probably benign
IGL02381:Rev3l APN 10 39,697,342 (GRCm39) missense possibly damaging 0.83
IGL02409:Rev3l APN 10 39,697,144 (GRCm39) missense possibly damaging 0.75
IGL02434:Rev3l APN 10 39,698,587 (GRCm39) missense probably damaging 1.00
IGL02570:Rev3l APN 10 39,724,009 (GRCm39) missense possibly damaging 0.68
IGL02581:Rev3l APN 10 39,697,277 (GRCm39) missense probably benign 0.10
IGL02654:Rev3l APN 10 39,738,730 (GRCm39) missense probably damaging 1.00
IGL02720:Rev3l APN 10 39,698,391 (GRCm39) nonsense probably null
IGL02746:Rev3l APN 10 39,700,585 (GRCm39) missense probably damaging 0.99
IGL02829:Rev3l APN 10 39,701,236 (GRCm39) missense probably damaging 1.00
IGL02961:Rev3l APN 10 39,703,941 (GRCm39) missense possibly damaging 0.65
IGL02974:Rev3l APN 10 39,738,743 (GRCm39) nonsense probably null
IGL03029:Rev3l APN 10 39,704,482 (GRCm39) missense probably benign 0.34
IGL03153:Rev3l APN 10 39,682,874 (GRCm39) missense probably damaging 1.00
IGL03172:Rev3l APN 10 39,700,786 (GRCm39) missense probably benign 0.10
R0068:Rev3l UTSW 10 39,700,827 (GRCm39) missense possibly damaging 0.68
R0068:Rev3l UTSW 10 39,700,827 (GRCm39) missense possibly damaging 0.68
R0153:Rev3l UTSW 10 39,750,124 (GRCm39) nonsense probably null
R0308:Rev3l UTSW 10 39,700,890 (GRCm39) missense probably benign 0.09
R0355:Rev3l UTSW 10 39,693,282 (GRCm39) missense probably damaging 1.00
R0513:Rev3l UTSW 10 39,704,139 (GRCm39) missense probably benign 0.00
R0523:Rev3l UTSW 10 39,724,045 (GRCm39) missense probably benign 0.02
R0559:Rev3l UTSW 10 39,700,483 (GRCm39) missense probably damaging 1.00
R0761:Rev3l UTSW 10 39,750,191 (GRCm39) missense probably benign 0.32
R1023:Rev3l UTSW 10 39,708,635 (GRCm39) missense probably damaging 1.00
R1159:Rev3l UTSW 10 39,727,921 (GRCm39) nonsense probably null
R1398:Rev3l UTSW 10 39,697,579 (GRCm39) missense probably benign 0.05
R1478:Rev3l UTSW 10 39,659,329 (GRCm39) critical splice donor site probably null
R1517:Rev3l UTSW 10 39,714,439 (GRCm39) missense probably benign 0.34
R1527:Rev3l UTSW 10 39,698,818 (GRCm39) missense probably damaging 1.00
R1635:Rev3l UTSW 10 39,682,658 (GRCm39) missense probably damaging 0.98
R1695:Rev3l UTSW 10 39,700,612 (GRCm39) missense probably damaging 0.97
R1695:Rev3l UTSW 10 39,700,611 (GRCm39) nonsense probably null
R1782:Rev3l UTSW 10 39,675,881 (GRCm39) missense probably benign
R1815:Rev3l UTSW 10 39,698,867 (GRCm39) missense probably benign 0.41
R1818:Rev3l UTSW 10 39,704,420 (GRCm39) missense probably benign 0.05
R2039:Rev3l UTSW 10 39,700,440 (GRCm39) missense probably damaging 1.00
R2071:Rev3l UTSW 10 39,700,349 (GRCm39) missense probably benign 0.17
R2101:Rev3l UTSW 10 39,704,092 (GRCm39) missense probably benign 0.00
R2141:Rev3l UTSW 10 39,724,045 (GRCm39) missense probably benign 0.02
R2883:Rev3l UTSW 10 39,701,152 (GRCm39) missense probably damaging 1.00
R3787:Rev3l UTSW 10 39,722,206 (GRCm39) missense probably damaging 0.97
R3910:Rev3l UTSW 10 39,696,552 (GRCm39) missense probably damaging 1.00
R3912:Rev3l UTSW 10 39,696,552 (GRCm39) missense probably damaging 1.00
R3913:Rev3l UTSW 10 39,696,552 (GRCm39) missense probably damaging 1.00
R4590:Rev3l UTSW 10 39,682,929 (GRCm39) missense probably damaging 1.00
R4631:Rev3l UTSW 10 39,704,412 (GRCm39) missense probably benign 0.44
R4633:Rev3l UTSW 10 39,722,182 (GRCm39) missense probably damaging 1.00
R4707:Rev3l UTSW 10 39,699,393 (GRCm39) missense probably damaging 0.99
R4724:Rev3l UTSW 10 39,722,802 (GRCm39) nonsense probably null
R4810:Rev3l UTSW 10 39,699,721 (GRCm39) missense probably benign 0.01
R4857:Rev3l UTSW 10 39,714,455 (GRCm39) missense probably damaging 1.00
R4882:Rev3l UTSW 10 39,697,456 (GRCm39) missense possibly damaging 0.89
R4970:Rev3l UTSW 10 39,699,326 (GRCm39) missense probably benign 0.00
R4977:Rev3l UTSW 10 39,699,574 (GRCm39) missense possibly damaging 0.80
R5112:Rev3l UTSW 10 39,699,326 (GRCm39) missense probably benign 0.00
R5261:Rev3l UTSW 10 39,722,725 (GRCm39) missense probably damaging 1.00
R5419:Rev3l UTSW 10 39,700,927 (GRCm39) missense possibly damaging 0.95
R5570:Rev3l UTSW 10 39,728,071 (GRCm39) critical splice donor site probably null
R5628:Rev3l UTSW 10 39,698,963 (GRCm39) missense probably damaging 0.98
R5689:Rev3l UTSW 10 39,670,954 (GRCm39) missense probably damaging 1.00
R5781:Rev3l UTSW 10 39,699,089 (GRCm39) missense probably benign 0.00
R5829:Rev3l UTSW 10 39,682,902 (GRCm39) missense probably damaging 0.97
R5984:Rev3l UTSW 10 39,618,685 (GRCm39) intron probably benign
R5990:Rev3l UTSW 10 39,699,807 (GRCm39) missense probably benign 0.17
R6054:Rev3l UTSW 10 39,700,146 (GRCm39) missense probably benign 0.01
R6171:Rev3l UTSW 10 39,738,709 (GRCm39) nonsense probably null
R6220:Rev3l UTSW 10 39,698,775 (GRCm39) missense probably damaging 1.00
R6520:Rev3l UTSW 10 39,698,698 (GRCm39) missense probably benign 0.06
R6798:Rev3l UTSW 10 39,730,759 (GRCm39) missense probably damaging 1.00
R6811:Rev3l UTSW 10 39,706,917 (GRCm39) nonsense probably null
R6812:Rev3l UTSW 10 39,699,544 (GRCm39) missense probably benign
R6904:Rev3l UTSW 10 39,697,477 (GRCm39) missense probably benign
R6905:Rev3l UTSW 10 39,693,323 (GRCm39) missense probably benign 0.18
R6938:Rev3l UTSW 10 39,738,706 (GRCm39) missense probably damaging 1.00
R7037:Rev3l UTSW 10 39,727,971 (GRCm39) missense probably damaging 1.00
R7124:Rev3l UTSW 10 39,698,163 (GRCm39) nonsense probably null
R7286:Rev3l UTSW 10 39,699,601 (GRCm39) missense probably damaging 0.99
R7385:Rev3l UTSW 10 39,699,678 (GRCm39) missense probably benign 0.01
R7575:Rev3l UTSW 10 39,697,441 (GRCm39) missense possibly damaging 0.56
R7596:Rev3l UTSW 10 39,697,534 (GRCm39) missense probably damaging 1.00
R7597:Rev3l UTSW 10 39,698,880 (GRCm39) missense probably damaging 1.00
R7670:Rev3l UTSW 10 39,712,718 (GRCm39) missense probably benign 0.01
R7804:Rev3l UTSW 10 39,699,481 (GRCm39) missense probably benign 0.34
R7818:Rev3l UTSW 10 39,699,898 (GRCm39) missense possibly damaging 0.54
R7874:Rev3l UTSW 10 39,698,491 (GRCm39) missense possibly damaging 0.72
R7991:Rev3l UTSW 10 39,739,734 (GRCm39) missense possibly damaging 0.52
R8059:Rev3l UTSW 10 39,719,491 (GRCm39) missense probably damaging 1.00
R8174:Rev3l UTSW 10 39,735,111 (GRCm39) missense probably damaging 1.00
R8187:Rev3l UTSW 10 39,682,693 (GRCm39) missense probably benign
R8299:Rev3l UTSW 10 39,697,537 (GRCm39) missense probably benign 0.01
R8352:Rev3l UTSW 10 39,698,899 (GRCm39) missense probably damaging 1.00
R8452:Rev3l UTSW 10 39,698,899 (GRCm39) missense probably damaging 1.00
R8468:Rev3l UTSW 10 39,703,987 (GRCm39) missense probably damaging 0.99
R8487:Rev3l UTSW 10 39,682,844 (GRCm39) missense probably damaging 1.00
R8512:Rev3l UTSW 10 39,697,534 (GRCm39) missense probably damaging 1.00
R8554:Rev3l UTSW 10 39,682,838 (GRCm39) missense probably benign 0.12
R8702:Rev3l UTSW 10 39,714,465 (GRCm39) nonsense probably null
R8848:Rev3l UTSW 10 39,722,705 (GRCm39) missense probably damaging 0.99
R8857:Rev3l UTSW 10 39,670,965 (GRCm39) nonsense probably null
R8870:Rev3l UTSW 10 39,738,786 (GRCm39) missense probably damaging 1.00
R9094:Rev3l UTSW 10 39,700,809 (GRCm39) missense probably benign
R9175:Rev3l UTSW 10 39,730,764 (GRCm39) missense possibly damaging 0.83
R9286:Rev3l UTSW 10 39,682,947 (GRCm39) missense possibly damaging 0.54
R9299:Rev3l UTSW 10 39,723,999 (GRCm39) missense probably damaging 1.00
R9307:Rev3l UTSW 10 39,693,149 (GRCm39) missense probably benign 0.01
R9337:Rev3l UTSW 10 39,698,850 (GRCm39) missense probably benign 0.40
R9342:Rev3l UTSW 10 39,697,458 (GRCm39) missense probably benign
R9389:Rev3l UTSW 10 39,698,967 (GRCm39) missense possibly damaging 0.47
R9395:Rev3l UTSW 10 39,735,219 (GRCm39) critical splice donor site probably null
R9458:Rev3l UTSW 10 39,659,247 (GRCm39) missense probably damaging 1.00
R9481:Rev3l UTSW 10 39,701,033 (GRCm39) missense probably benign
R9646:Rev3l UTSW 10 39,698,440 (GRCm39) missense probably damaging 1.00
R9686:Rev3l UTSW 10 39,743,384 (GRCm39) missense possibly damaging 0.67
X0022:Rev3l UTSW 10 39,704,603 (GRCm39) critical splice donor site probably null
Z1088:Rev3l UTSW 10 39,700,314 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CTGCAAAGACAGTCAGCAGC -3'
(R):5'- TCTTATCTGGCTGATGAGTAGACG -3'

Sequencing Primer
(F):5'- CTGTGAGTGTGTCAGAACAATC -3'
(R):5'- CGTTGAGTCTTGTACGACATTTGTAC -3'
Posted On 2016-04-15