Mutagenetix > Incidental Mutation

Incidental Mutation 'R4928:Tanc2'

381032

Institutional Source

Beutler Lab

Gene Symbol

Tanc2

Ensembl Gene

ENSMUSG00000053580

Gene Name

tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2

Synonyms

5730590C14Rik, 3526402J09Rik

MMRRC Submission

042529-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4928 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105589986-105929304 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 105867762 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 783 (L783P)

Ref Sequence

ENSEMBL: ENSMUSP00000097904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100330]

AlphaFold

A2A690

Predicted Effect

probably damaging
Transcript: ENSMUST00000100330
AA Change: L783P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: L783P

Domain	Start	End	E-Value	Type
low complexity region	32	50	N/A	INTRINSIC
low complexity region	129	152	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
low complexity region	436	447	N/A	INTRINSIC
low complexity region	823	834	N/A	INTRINSIC
ANK	846	878	2.08e3	SMART
ANK	882	913	2.97e2	SMART
ANK	917	946	5.75e-1	SMART
ANK	950	979	8.62e1	SMART
ANK	990	1018	1.16e3	SMART
ANK	1033	1062	3.31e-1	SMART
ANK	1066	1095	7.71e-2	SMART
ANK	1099	1128	6.12e-5	SMART
ANK	1132	1161	8.99e-3	SMART
ANK	1165	1194	5.71e-5	SMART
ANK	1198	1227	2.11e2	SMART
TPR	1244	1277	3.89e1	SMART
TPR	1291	1324	3.61e-2	SMART
TPR	1325	1358	2.82e-4	SMART
low complexity region	1369	1406	N/A	INTRINSIC
low complexity region	1533	1539	N/A	INTRINSIC
low complexity region	1787	1802	N/A	INTRINSIC

Meta Mutation Damage Score

0.9191

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

98% (123/126)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530021J07Rik	G	T	7: 83,155,878		noncoding transcript	Het
Aasdh	T	A	5: 76,896,688	K118N	possibly damaging	Het
Abca14	A	T	7: 120,324,580	N1620I	possibly damaging	Het
Acap1	A	T	11: 69,885,815	S149T	possibly damaging	Het
Adgre1	T	A	17: 57,444,064	Y579*	probably null	Het
AI314180	A	G	4: 58,827,073	V1020A	probably damaging	Het
Aifm3	T	C	16: 17,500,432		probably benign	Het
Aldh16a1	A	G	7: 45,141,961	W107R	probably damaging	Het
Amer2	A	T	14: 60,379,445	H363L	possibly damaging	Het
Arhgap10	A	G	8: 77,426,328		probably null	Het
Arhgef6	A	T	X: 57,234,878	D742E	probably damaging	Het
Astn2	A	T	4: 65,729,407	N731K	probably damaging	Het
Atp1a2	T	C	1: 172,278,387	T904A	possibly damaging	Het
Atr	C	T	9: 95,907,299	R1503W	probably damaging	Het
Cdh3	G	T	8: 106,536,610	R97L	probably benign	Het
Chst2	C	T	9: 95,406,006	V96I	probably benign	Het
Cit	T	A	5: 115,985,797	N1464K	probably benign	Het
Col17a1	A	T	19: 47,670,458		probably null	Het
Col4a3	G	A	1: 82,710,977		probably benign	Het
Copz1	T	A	15: 103,291,330	S57R	probably damaging	Het
Cpped1	A	T	16: 11,828,279	F227Y	probably damaging	Het
Cyp2j12	A	T	4: 96,102,151		probably null	Het
Dctn1	T	A	6: 83,189,207	I195N	possibly damaging	Het
Dhrs7b	A	G	11: 60,851,925	I148V	probably benign	Het
Dnah17	T	C	11: 118,027,433	D4096G	probably damaging	Het
Dnajc13	T	C	9: 104,233,638	N145D	possibly damaging	Het
Ercc6l2	T	C	13: 63,894,813		probably benign	Het
Fads6	T	G	11: 115,296,561	I103L	probably benign	Het
Fam189a1	G	T	7: 64,759,368	S426*	probably null	Het
Fat4	T	G	3: 39,010,465	Y4857D	probably damaging	Het
Fbxl14	T	A	6: 119,480,710	L284Q	probably damaging	Het
Fkbp9	T	C	6: 56,849,670	V85A	possibly damaging	Het
Galnt13	T	A	2: 54,516,565	V9E	probably damaging	Het
Gm14412	A	T	2: 177,314,580	S507R	probably benign	Het
Gm15142	T	A	X: 154,638,419		noncoding transcript	Het
Gm4787	T	C	12: 81,378,838	E182G	probably benign	Het
Gm6811	C	A	17: 21,094,631		noncoding transcript	Het
Gm9791	A	T	3: 34,005,069		noncoding transcript	Het
Hoxb7	A	T	11: 96,289,510		probably null	Het
Ift122	T	A	6: 115,915,858		probably benign	Het
Krt28	C	T	11: 99,374,632	V70I	probably benign	Het
Lig1	T	C	7: 13,298,738	S459P	probably damaging	Het
Lrfn3	C	T	7: 30,360,623	R59H	possibly damaging	Het
Mavs	T	C	2: 131,246,743	V489A	probably benign	Het
Mcm8	C	T	2: 132,839,479	P625L	probably benign	Het
Megf10	G	T	18: 57,240,673	R181L	probably benign	Het
Mgrn1	G	A	16: 4,927,862	G440D	probably benign	Het
Mllt3	T	C	4: 87,782,405		probably null	Het
Muc5ac	T	A	7: 141,817,902	Y2613*	probably null	Het
Myh14	C	T	7: 44,635,502	G662S	probably benign	Het
Myod1	T	A	7: 46,377,050	N126K	probably damaging	Het
Nae1	A	T	8: 104,516,142	H439Q	possibly damaging	Het
Narf	T	A	11: 121,244,939	V136E	possibly damaging	Het
Ncapd3	T	A	9: 27,071,735	C926*	probably null	Het
Ndufv2	C	A	17: 66,092,658		probably null	Het
Neb	T	C	2: 52,212,975	S449G	possibly damaging	Het
Nek10	C	T	14: 14,930,577	P698L	probably damaging	Het
Nox3	T	A	17: 3,635,275	E566V	probably null	Het
Oas1a	C	T	5: 120,905,724	R115H	probably benign	Het
Olfr1076	T	A	2: 86,509,125	L222H	probably damaging	Het
Olfr1130	C	A	2: 87,608,143	L252I	probably benign	Het
Olfr1152	A	G	2: 87,868,230	M80V	probably benign	Het
Olfr65	A	G	7: 103,906,672	T78A	probably damaging	Het
Pbld2	A	G	10: 63,047,999	H142R	probably damaging	Het
Pcdha4	C	T	18: 36,954,816	T684M	probably benign	Het
Phc3	G	T	3: 30,950,919	T175N	probably damaging	Het
Pigs	G	T	11: 78,329,002	V68L	probably damaging	Het
Pik3c2g	T	A	6: 139,967,802	D857E	possibly damaging	Het
Pitpnm3	G	A	11: 72,063,172	P550S	probably damaging	Het
Pla2g15	G	A	8: 106,163,218	W374*	probably null	Het
Ptpn14	G	A	1: 189,822,642	C133Y	probably damaging	Het
Ptpn20	A	G	14: 33,614,489	N95S	probably benign	Het
Ptrh2	G	T	11: 86,690,036	V160F	probably damaging	Het
Rapgef3	T	C	15: 97,757,375	D486G	probably damaging	Het
Rev3l	T	G	10: 39,823,985	S1493A	probably benign	Het
Rgs9	T	A	11: 109,225,744	D411V	probably benign	Het
Rgsl1	A	T	1: 153,793,768	Y291N	probably damaging	Het
Rprd2	A	G	3: 95,764,537	Y1185H	probably damaging	Het
Rpusd3	A	G	6: 113,416,206		probably benign	Het
Scnn1a	T	C	6: 125,322,173	I72T	probably damaging	Het
Sdk1	A	T	5: 141,857,003		probably benign	Het
Sfmbt2	T	C	2: 10,445,745	L277P	probably benign	Het
Sgf29	A	G	7: 126,664,982	E73G	probably damaging	Het
Slc12a6	T	A	2: 112,352,961	F764L	probably damaging	Het
Slc4a2	T	C	5: 24,435,342		probably null	Het
Slc9a3	T	G	13: 74,157,719	V285G	probably damaging	Het
Slc9c1	A	G	16: 45,575,409	T608A	probably benign	Het
Slfnl1	C	T	4: 120,535,685	R325C	probably damaging	Het
Smarcad1	T	A	6: 65,074,914	F344I	probably benign	Het
Snrnp70	A	T	7: 45,377,281		probably null	Het
Sod2	C	T	17: 13,008,186	T9M	probably benign	Het
Spag5	T	A	11: 78,314,373	S633T	probably damaging	Het
Spta1	A	T	1: 174,191,056	I531L	probably benign	Het
Stra8	A	G	6: 34,933,156	E60G	probably benign	Het
Sult2a3	T	A	7: 14,111,557	I126F	probably benign	Het
Syt1	T	C	10: 108,504,512	H315R	possibly damaging	Het
Thbs2	C	T	17: 14,678,900	C646Y	probably damaging	Het
Ticam2	T	A	18: 46,560,922	K33*	probably null	Het
Trim17	T	C	11: 58,954,301		probably benign	Het
Tsr1	G	A	11: 74,907,879	M691I	probably benign	Het
Ttn	T	A	2: 76,762,419	I20790F	probably damaging	Het
Tubb2b	A	T	13: 34,128,185	Y208*	probably null	Het
Ubr1	T	A	2: 120,914,938	I890F	probably damaging	Het
Usp54	T	C	14: 20,562,192	E852G	probably damaging	Het
Vmn2r78	T	C	7: 86,954,627	V671A	probably damaging	Het
Wipi1	T	C	11: 109,579,649	K315E	probably benign	Het
Xrn2	T	C	2: 147,051,718	V735A	possibly damaging	Het
Zdbf2	T	A	1: 63,308,814	D2117E	possibly damaging	Het
Zfp287	A	T	11: 62,714,136	C648*	probably null	Het
Zfp369	A	G	13: 65,296,800	T586A	possibly damaging	Het

Other mutations in Tanc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Tanc2	APN	11	105923220	missense	probably benign	0.28
IGL00688:Tanc2	APN	11	105798690	missense	probably damaging	1.00
IGL00709:Tanc2	APN	11	105798795	missense	probably damaging	1.00
IGL01013:Tanc2	APN	11	105625065	missense	probably damaging	0.96
IGL01141:Tanc2	APN	11	105886474	splice site	probably benign
IGL01386:Tanc2	APN	11	105886381	missense	probably damaging	0.99
IGL01433:Tanc2	APN	11	105810522	missense	possibly damaging	0.75
IGL01562:Tanc2	APN	11	105780069	missense	probably benign	0.00
IGL01979:Tanc2	APN	11	105776920	missense	probably benign
IGL02104:Tanc2	APN	11	105780133	unclassified	probably benign
IGL02434:Tanc2	APN	11	105780042	missense	probably benign	0.14
IGL02534:Tanc2	APN	11	105835168	missense	probably damaging	1.00
IGL02568:Tanc2	APN	11	105776951	missense	probably benign	0.00
IGL03279:Tanc2	APN	11	105913092	splice site	probably null
R0595:Tanc2	UTSW	11	105714177	splice site	probably null
R1131:Tanc2	UTSW	11	105835002	missense	probably damaging	1.00
R1320:Tanc2	UTSW	11	105886444	missense	probably damaging	1.00
R1487:Tanc2	UTSW	11	105923634	missense	probably damaging	0.99
R1497:Tanc2	UTSW	11	105922137	missense	probably benign	0.21
R1692:Tanc2	UTSW	11	105857500	missense	probably benign
R1712:Tanc2	UTSW	11	105899780	missense	probably benign
R1793:Tanc2	UTSW	11	105625033	critical splice acceptor site	probably null
R1812:Tanc2	UTSW	11	105886386	missense	probably benign	0.01
R1905:Tanc2	UTSW	11	105922863	missense	possibly damaging	0.61
R1959:Tanc2	UTSW	11	105910295	missense	probably damaging	1.00
R1962:Tanc2	UTSW	11	105798732	missense	probably benign	0.14
R2122:Tanc2	UTSW	11	105895949	missense	probably damaging	1.00
R2174:Tanc2	UTSW	11	105910309	missense	probably benign	0.00
R2341:Tanc2	UTSW	11	105835051	missense	probably benign	0.09
R2497:Tanc2	UTSW	11	105673493	critical splice donor site	probably null
R3438:Tanc2	UTSW	11	105857575	missense	probably damaging	0.97
R3711:Tanc2	UTSW	11	105798690	missense	probably damaging	1.00
R3765:Tanc2	UTSW	11	105914970	missense	probably damaging	1.00
R3890:Tanc2	UTSW	11	105798678	missense	probably damaging	1.00
R4193:Tanc2	UTSW	11	105914062	intron	probably benign
R4609:Tanc2	UTSW	11	105910240	missense	probably benign	0.24
R4674:Tanc2	UTSW	11	105867480	missense	probably damaging	1.00
R5008:Tanc2	UTSW	11	105625060	start codon destroyed	probably null	0.46
R5010:Tanc2	UTSW	11	105780092	missense	probably damaging	1.00
R5135:Tanc2	UTSW	11	105857553	missense	possibly damaging	0.93
R5385:Tanc2	UTSW	11	105776846	missense	probably damaging	0.99
R5409:Tanc2	UTSW	11	105867485	missense	possibly damaging	0.93
R5419:Tanc2	UTSW	11	105922883	missense	probably benign	0.00
R5501:Tanc2	UTSW	11	105914985	critical splice donor site	probably null
R5590:Tanc2	UTSW	11	105923306	missense	probably damaging	0.99
R5651:Tanc2	UTSW	11	105798700	missense	probably benign	0.44
R5798:Tanc2	UTSW	11	105921855	small deletion	probably benign
R5876:Tanc2	UTSW	11	105922613	missense	possibly damaging	0.71
R5889:Tanc2	UTSW	11	105921807	missense	probably benign	0.23
R5958:Tanc2	UTSW	11	105840625	missense	probably benign	0.00
R5999:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6024:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6024:Tanc2	UTSW	11	105923672	missense	probably damaging	1.00
R6025:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6025:Tanc2	UTSW	11	105896547	missense	possibly damaging	0.68
R6048:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6049:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6185:Tanc2	UTSW	11	105913039	missense	probably damaging	1.00
R6335:Tanc2	UTSW	11	105857556	missense	probably damaging	0.99
R6821:Tanc2	UTSW	11	105886490	splice site	probably null
R6846:Tanc2	UTSW	11	105798653	missense	probably benign	0.34
R6857:Tanc2	UTSW	11	105910288	missense	possibly damaging	0.81
R6904:Tanc2	UTSW	11	105835230	missense	possibly damaging	0.89
R7009:Tanc2	UTSW	11	105840699	missense	possibly damaging	0.47
R7017:Tanc2	UTSW	11	105923108	missense	probably benign
R7371:Tanc2	UTSW	11	105798596	missense	probably benign
R7556:Tanc2	UTSW	11	105909031	missense
R7630:Tanc2	UTSW	11	105776908	missense	probably benign	0.04
R7693:Tanc2	UTSW	11	105923467	missense	probably damaging	1.00
R7757:Tanc2	UTSW	11	105776858	missense	possibly damaging	0.81
R7807:Tanc2	UTSW	11	105867654	missense	probably benign	0.00
R7878:Tanc2	UTSW	11	105913415	missense
R7895:Tanc2	UTSW	11	105921825	missense	probably damaging	1.00
R7952:Tanc2	UTSW	11	105896597	missense	probably damaging	1.00
R8099:Tanc2	UTSW	11	105864007	missense	probably benign	0.17
R8117:Tanc2	UTSW	11	105835162	missense	probably damaging	1.00
R8133:Tanc2	UTSW	11	105923222	missense	probably damaging	0.97
R8422:Tanc2	UTSW	11	105835188	missense	probably benign	0.10
R8527:Tanc2	UTSW	11	105917008	missense	probably damaging	0.96
R8542:Tanc2	UTSW	11	105917008	missense	probably damaging	0.96
R8834:Tanc2	UTSW	11	105917019	missense
R8912:Tanc2	UTSW	11	105867327	missense	probably benign	0.01
R8927:Tanc2	UTSW	11	105810505	missense	probably damaging	0.99
R8928:Tanc2	UTSW	11	105810505	missense	probably damaging	0.99
R8968:Tanc2	UTSW	11	105867574	missense	possibly damaging	0.50
R9065:Tanc2	UTSW	11	105798692	nonsense	probably null
R9095:Tanc2	UTSW	11	105867278	missense	probably benign	0.00
R9108:Tanc2	UTSW	11	105919754	intron	probably benign
R9131:Tanc2	UTSW	11	105798777	missense	probably benign
R9294:Tanc2	UTSW	11	105886458	missense	probably damaging	0.99
R9445:Tanc2	UTSW	11	105867464	missense	possibly damaging	0.80
X0027:Tanc2	UTSW	11	105835183	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- TTTCCAGGCCATCAATGCTGG -3'
(R):5'- CCGCAGTGTTAGAGCTTTGGTC -3'

Sequencing Primer
(F):5'- CTGGGAGCATTGAAGGCACAC -3'
(R):5'- TGATGAGTCACAGTCTGAGTAAC -3'

Posted On

2016-04-15