Incidental Mutation 'R4928:Usp54'
ID 381043
Institutional Source Beutler Lab
Gene Symbol Usp54
Ensembl Gene ENSMUSG00000034235
Gene Name ubiquitin specific peptidase 54
Synonyms 4930429G18Rik, C030002J06Rik
MMRRC Submission 042529-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4928 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 20598980-20691131 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20612260 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 852 (E852G)
Ref Sequence ENSEMBL: ENSMUSP00000036214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022356] [ENSMUST00000035340]
AlphaFold Q8BL06
Predicted Effect probably damaging
Transcript: ENSMUST00000022356
AA Change: E852G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022356
Gene: ENSMUSG00000034235
AA Change: E852G

DomainStartEndE-ValueType
Pfam:UCH 30 349 2.4e-23 PFAM
Pfam:UCH_1 31 324 2.1e-7 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000035340
AA Change: E852G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036214
Gene: ENSMUSG00000034235
AA Change: E852G

DomainStartEndE-ValueType
Pfam:UCH 31 349 2.3e-21 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224755
Meta Mutation Damage Score 0.1840 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 82,805,086 (GRCm39) noncoding transcript Het
Aasdh T A 5: 77,044,535 (GRCm39) K118N possibly damaging Het
Abca14 A T 7: 119,923,803 (GRCm39) N1620I possibly damaging Het
Acap1 A T 11: 69,776,641 (GRCm39) S149T possibly damaging Het
Adgre1 T A 17: 57,751,064 (GRCm39) Y579* probably null Het
Aifm3 T C 16: 17,318,296 (GRCm39) probably benign Het
Aldh16a1 A G 7: 44,791,385 (GRCm39) W107R probably damaging Het
Amer2 A T 14: 60,616,894 (GRCm39) H363L possibly damaging Het
Arhgap10 A G 8: 78,152,957 (GRCm39) probably null Het
Arhgef6 A T X: 56,280,238 (GRCm39) D742E probably damaging Het
Astn2 A T 4: 65,647,644 (GRCm39) N731K probably damaging Het
Atp1a2 T C 1: 172,105,954 (GRCm39) T904A possibly damaging Het
Atr C T 9: 95,789,352 (GRCm39) R1503W probably damaging Het
Cdh3 G T 8: 107,263,242 (GRCm39) R97L probably benign Het
Chst2 C T 9: 95,288,059 (GRCm39) V96I probably benign Het
Cit T A 5: 116,123,856 (GRCm39) N1464K probably benign Het
Col17a1 A T 19: 47,658,897 (GRCm39) probably null Het
Col4a3 G A 1: 82,688,698 (GRCm39) probably benign Het
Copz1 T A 15: 103,199,757 (GRCm39) S57R probably damaging Het
Cpped1 A T 16: 11,646,143 (GRCm39) F227Y probably damaging Het
Cyp2j12 A T 4: 95,990,388 (GRCm39) probably null Het
Dctn1 T A 6: 83,166,189 (GRCm39) I195N possibly damaging Het
Dhrs7b A G 11: 60,742,751 (GRCm39) I148V probably benign Het
Dnah17 T C 11: 117,918,259 (GRCm39) D4096G probably damaging Het
Dnajc13 T C 9: 104,110,837 (GRCm39) N145D possibly damaging Het
Ecpas A G 4: 58,827,073 (GRCm39) V1020A probably damaging Het
Entrep2 G T 7: 64,409,116 (GRCm39) S426* probably null Het
Ercc6l2 T C 13: 64,042,627 (GRCm39) probably benign Het
Fads6 T G 11: 115,187,387 (GRCm39) I103L probably benign Het
Fat4 T G 3: 39,064,614 (GRCm39) Y4857D probably damaging Het
Fbxl14 T A 6: 119,457,671 (GRCm39) L284Q probably damaging Het
Fkbp9 T C 6: 56,826,655 (GRCm39) V85A possibly damaging Het
Galnt13 T A 2: 54,406,577 (GRCm39) V9E probably damaging Het
Gm14412 A T 2: 177,006,373 (GRCm39) S507R probably benign Het
Gm15142 T A X: 153,421,415 (GRCm39) noncoding transcript Het
Gm4787 T C 12: 81,425,612 (GRCm39) E182G probably benign Het
Gm6811 C A 17: 21,314,893 (GRCm39) noncoding transcript Het
Gm9791 A T 3: 34,059,218 (GRCm39) noncoding transcript Het
Hoxb7 A T 11: 96,180,336 (GRCm39) probably null Het
Ift122 T A 6: 115,892,819 (GRCm39) probably benign Het
Krt28 C T 11: 99,265,458 (GRCm39) V70I probably benign Het
Lig1 T C 7: 13,032,664 (GRCm39) S459P probably damaging Het
Lrfn3 C T 7: 30,060,048 (GRCm39) R59H possibly damaging Het
Mavs T C 2: 131,088,663 (GRCm39) V489A probably benign Het
Mcm8 C T 2: 132,681,399 (GRCm39) P625L probably benign Het
Megf10 G T 18: 57,373,745 (GRCm39) R181L probably benign Het
Mgrn1 G A 16: 4,745,726 (GRCm39) G440D probably benign Het
Mllt3 T C 4: 87,700,642 (GRCm39) probably null Het
Muc5ac T A 7: 141,371,639 (GRCm39) Y2613* probably null Het
Myh14 C T 7: 44,284,926 (GRCm39) G662S probably benign Het
Myod1 T A 7: 46,026,474 (GRCm39) N126K probably damaging Het
Nae1 A T 8: 105,242,774 (GRCm39) H439Q possibly damaging Het
Narf T A 11: 121,135,765 (GRCm39) V136E possibly damaging Het
Ncapd3 T A 9: 26,983,031 (GRCm39) C926* probably null Het
Ndufv2 C A 17: 66,399,653 (GRCm39) probably null Het
Neb T C 2: 52,102,987 (GRCm39) S449G possibly damaging Het
Nek10 C T 14: 14,930,577 (GRCm38) P698L probably damaging Het
Nox3 T A 17: 3,685,550 (GRCm39) E566V probably null Het
Oas1a C T 5: 121,043,787 (GRCm39) R115H probably benign Het
Or10ag60 C A 2: 87,438,487 (GRCm39) L252I probably benign Het
Or51b6 A G 7: 103,555,879 (GRCm39) T78A probably damaging Het
Or5w19 A G 2: 87,698,574 (GRCm39) M80V probably benign Het
Or8k30 T A 2: 86,339,469 (GRCm39) L222H probably damaging Het
Pbld2 A G 10: 62,883,778 (GRCm39) H142R probably damaging Het
Pcdha4 C T 18: 37,087,869 (GRCm39) T684M probably benign Het
Phc3 G T 3: 31,005,068 (GRCm39) T175N probably damaging Het
Pigs G T 11: 78,219,828 (GRCm39) V68L probably damaging Het
Pik3c2g T A 6: 139,913,528 (GRCm39) D857E possibly damaging Het
Pitpnm3 G A 11: 71,953,998 (GRCm39) P550S probably damaging Het
Pla2g15 G A 8: 106,889,850 (GRCm39) W374* probably null Het
Ptpn14 G A 1: 189,554,839 (GRCm39) C133Y probably damaging Het
Ptpn20 A G 14: 33,336,446 (GRCm39) N95S probably benign Het
Ptrh2 G T 11: 86,580,862 (GRCm39) V160F probably damaging Het
Rapgef3 T C 15: 97,655,256 (GRCm39) D486G probably damaging Het
Rev3l T G 10: 39,699,981 (GRCm39) S1493A probably benign Het
Rgs9 T A 11: 109,116,570 (GRCm39) D411V probably benign Het
Rgsl1 A T 1: 153,669,514 (GRCm39) Y291N probably damaging Het
Rprd2 A G 3: 95,671,849 (GRCm39) Y1185H probably damaging Het
Rpusd3 A G 6: 113,393,167 (GRCm39) probably benign Het
Scnn1a T C 6: 125,299,136 (GRCm39) I72T probably damaging Het
Sdk1 A T 5: 141,842,758 (GRCm39) probably benign Het
Sfmbt2 T C 2: 10,450,556 (GRCm39) L277P probably benign Het
Sgf29 A G 7: 126,264,154 (GRCm39) E73G probably damaging Het
Slc12a6 T A 2: 112,183,306 (GRCm39) F764L probably damaging Het
Slc4a2 T C 5: 24,640,340 (GRCm39) probably null Het
Slc9a3 T G 13: 74,305,838 (GRCm39) V285G probably damaging Het
Slc9c1 A G 16: 45,395,772 (GRCm39) T608A probably benign Het
Slfnl1 C T 4: 120,392,882 (GRCm39) R325C probably damaging Het
Smarcad1 T A 6: 65,051,898 (GRCm39) F344I probably benign Het
Snrnp70 A T 7: 45,026,705 (GRCm39) probably null Het
Sod2 C T 17: 13,227,073 (GRCm39) T9M probably benign Het
Spag5 T A 11: 78,205,199 (GRCm39) S633T probably damaging Het
Spta1 A T 1: 174,018,622 (GRCm39) I531L probably benign Het
Stra8 A G 6: 34,910,091 (GRCm39) E60G probably benign Het
Sult2a3 T A 7: 13,845,482 (GRCm39) I126F probably benign Het
Syt1 T C 10: 108,340,373 (GRCm39) H315R possibly damaging Het
Tanc2 T C 11: 105,758,588 (GRCm39) L783P probably damaging Het
Thbs2 C T 17: 14,899,162 (GRCm39) C646Y probably damaging Het
Ticam2 T A 18: 46,693,989 (GRCm39) K33* probably null Het
Trim17 T C 11: 58,845,127 (GRCm39) probably benign Het
Tsr1 G A 11: 74,798,705 (GRCm39) M691I probably benign Het
Ttn T A 2: 76,592,763 (GRCm39) I20790F probably damaging Het
Tubb2b A T 13: 34,312,168 (GRCm39) Y208* probably null Het
Ubr1 T A 2: 120,745,419 (GRCm39) I890F probably damaging Het
Vmn2r78 T C 7: 86,603,835 (GRCm39) V671A probably damaging Het
Wipi1 T C 11: 109,470,475 (GRCm39) K315E probably benign Het
Xrn2 T C 2: 146,893,638 (GRCm39) V735A possibly damaging Het
Zdbf2 T A 1: 63,347,973 (GRCm39) D2117E possibly damaging Het
Zfp287 A T 11: 62,604,962 (GRCm39) C648* probably null Het
Zfp369 A G 13: 65,444,614 (GRCm39) T586A possibly damaging Het
Other mutations in Usp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Usp54 APN 14 20,623,905 (GRCm39) missense probably damaging 1.00
IGL01090:Usp54 APN 14 20,636,225 (GRCm39) unclassified probably benign
IGL02030:Usp54 APN 14 20,616,014 (GRCm39) missense probably benign 0.44
IGL02333:Usp54 APN 14 20,639,463 (GRCm39) missense probably damaging 1.00
IGL02642:Usp54 APN 14 20,615,140 (GRCm39) splice site probably benign
IGL02970:Usp54 APN 14 20,627,540 (GRCm39) missense probably damaging 1.00
IGL03371:Usp54 APN 14 20,639,436 (GRCm39) unclassified probably benign
BB003:Usp54 UTSW 14 20,627,036 (GRCm39) missense probably damaging 1.00
BB013:Usp54 UTSW 14 20,627,036 (GRCm39) missense probably damaging 1.00
R0050:Usp54 UTSW 14 20,623,823 (GRCm39) unclassified probably benign
R0383:Usp54 UTSW 14 20,611,320 (GRCm39) missense probably benign 0.00
R0427:Usp54 UTSW 14 20,620,432 (GRCm39) missense probably benign
R0442:Usp54 UTSW 14 20,657,277 (GRCm39) missense probably damaging 1.00
R0574:Usp54 UTSW 14 20,606,322 (GRCm39) missense probably benign 0.00
R0638:Usp54 UTSW 14 20,639,437 (GRCm39) unclassified probably benign
R0789:Usp54 UTSW 14 20,612,225 (GRCm39) missense probably benign 0.01
R1272:Usp54 UTSW 14 20,611,178 (GRCm39) missense probably damaging 0.99
R1463:Usp54 UTSW 14 20,600,258 (GRCm39) missense probably benign 0.15
R1565:Usp54 UTSW 14 20,657,227 (GRCm39) missense probably damaging 1.00
R1721:Usp54 UTSW 14 20,633,508 (GRCm39) nonsense probably null
R1922:Usp54 UTSW 14 20,610,972 (GRCm39) missense probably benign 0.00
R2068:Usp54 UTSW 14 20,627,273 (GRCm39) missense probably damaging 1.00
R2216:Usp54 UTSW 14 20,611,908 (GRCm39) missense probably benign
R2285:Usp54 UTSW 14 20,611,246 (GRCm39) missense possibly damaging 0.52
R2426:Usp54 UTSW 14 20,615,008 (GRCm39) missense probably benign 0.00
R3855:Usp54 UTSW 14 20,638,488 (GRCm39) missense probably damaging 1.00
R3856:Usp54 UTSW 14 20,638,488 (GRCm39) missense probably damaging 1.00
R3907:Usp54 UTSW 14 20,636,181 (GRCm39) missense probably damaging 1.00
R4367:Usp54 UTSW 14 20,611,202 (GRCm39) missense probably benign 0.02
R4384:Usp54 UTSW 14 20,600,153 (GRCm39) splice site probably null
R4555:Usp54 UTSW 14 20,611,090 (GRCm39) missense probably benign 0.06
R4617:Usp54 UTSW 14 20,600,406 (GRCm39) missense probably benign 0.04
R4659:Usp54 UTSW 14 20,615,060 (GRCm39) missense probably damaging 1.00
R4672:Usp54 UTSW 14 20,631,597 (GRCm39) intron probably benign
R5381:Usp54 UTSW 14 20,636,144 (GRCm39) missense probably damaging 1.00
R5408:Usp54 UTSW 14 20,600,501 (GRCm39) missense probably damaging 1.00
R5630:Usp54 UTSW 14 20,615,125 (GRCm39) missense probably damaging 1.00
R5841:Usp54 UTSW 14 20,600,351 (GRCm39) missense probably benign 0.04
R5886:Usp54 UTSW 14 20,611,910 (GRCm39) missense probably benign 0.28
R5922:Usp54 UTSW 14 20,602,139 (GRCm39) splice site probably null
R5975:Usp54 UTSW 14 20,633,419 (GRCm39) missense possibly damaging 0.77
R6074:Usp54 UTSW 14 20,602,167 (GRCm39) missense probably benign 0.02
R6183:Usp54 UTSW 14 20,602,313 (GRCm39) missense probably damaging 0.99
R6234:Usp54 UTSW 14 20,633,518 (GRCm39) missense probably damaging 1.00
R6303:Usp54 UTSW 14 20,611,036 (GRCm39) missense possibly damaging 0.95
R6304:Usp54 UTSW 14 20,611,036 (GRCm39) missense possibly damaging 0.95
R6695:Usp54 UTSW 14 20,610,937 (GRCm39) missense possibly damaging 0.94
R6774:Usp54 UTSW 14 20,627,296 (GRCm39) missense probably damaging 1.00
R6941:Usp54 UTSW 14 20,612,177 (GRCm39) missense probably benign
R7133:Usp54 UTSW 14 20,611,310 (GRCm39) missense probably benign 0.00
R7196:Usp54 UTSW 14 20,638,438 (GRCm39) missense probably damaging 1.00
R7409:Usp54 UTSW 14 20,602,313 (GRCm39) missense probably damaging 0.99
R7424:Usp54 UTSW 14 20,627,108 (GRCm39) missense probably benign 0.15
R7859:Usp54 UTSW 14 20,638,204 (GRCm39) missense probably benign 0.24
R7926:Usp54 UTSW 14 20,627,036 (GRCm39) missense probably damaging 1.00
R7954:Usp54 UTSW 14 20,611,981 (GRCm39) missense probably benign 0.01
R8489:Usp54 UTSW 14 20,611,604 (GRCm39) missense probably benign 0.31
R8745:Usp54 UTSW 14 20,612,176 (GRCm39) missense probably benign 0.00
R8775:Usp54 UTSW 14 20,638,466 (GRCm39) missense probably benign 0.03
R8775-TAIL:Usp54 UTSW 14 20,638,466 (GRCm39) missense probably benign 0.03
R9080:Usp54 UTSW 14 20,612,308 (GRCm39) missense probably damaging 1.00
R9121:Usp54 UTSW 14 20,631,523 (GRCm39) critical splice donor site probably null
R9139:Usp54 UTSW 14 20,627,162 (GRCm39) missense probably benign 0.00
R9433:Usp54 UTSW 14 20,611,678 (GRCm39) missense probably benign
R9613:Usp54 UTSW 14 20,600,438 (GRCm39) missense probably damaging 0.97
RF004:Usp54 UTSW 14 20,611,368 (GRCm39) missense possibly damaging 0.90
X0024:Usp54 UTSW 14 20,627,319 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCTGTCCACCTCAAAAGACG -3'
(R):5'- CACATAGACAAATTGGATGGTACTCTC -3'

Sequencing Primer
(F):5'- CGTCAGAAGCTTCAAGGAAGATGTC -3'
(R):5'- GGCTGATTCTCTCCATTTG -3'
Posted On 2016-04-15