Incidental Mutation 'R4928:Thbs2'
ID 381052
Institutional Source Beutler Lab
Gene Symbol Thbs2
Ensembl Gene ENSMUSG00000023885
Gene Name thrombospondin 2
Synonyms Thrombospondin-2, Thbs-2, TSP2
MMRRC Submission 042529-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.218) question?
Stock # R4928 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 14885762-14914497 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 14899162 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 646 (C646Y)
Ref Sequence ENSEMBL: ENSMUSP00000128308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170872]
AlphaFold Q03350
Predicted Effect probably damaging
Transcript: ENSMUST00000170872
AA Change: C646Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: C646Y

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
TSPN 21 215 3.8e-60 SMART
VWC 320 374 3.55e-19 SMART
TSP1 384 431 3.36e-11 SMART
TSP1 440 492 1.35e-15 SMART
TSP1 497 549 8.6e-18 SMART
EGF 552 589 6.3e-3 SMART
EGF 593 647 1.56e1 SMART
EGF 651 692 2.19e-2 SMART
Pfam:TSP_3 729 764 2.5e-12 PFAM
Pfam:TSP_3 763 787 7.4e-7 PFAM
Pfam:TSP_3 788 823 9.4e-12 PFAM
Pfam:TSP_3 823 846 4.1e-7 PFAM
Pfam:TSP_3 847 884 1.7e-12 PFAM
Pfam:TSP_3 885 920 1.3e-11 PFAM
Pfam:TSP_3 921 956 3.1e-11 PFAM
Pfam:TSP_C 974 1171 1e-98 PFAM
Meta Mutation Damage Score 0.7599 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 82,805,086 (GRCm39) noncoding transcript Het
Aasdh T A 5: 77,044,535 (GRCm39) K118N possibly damaging Het
Abca14 A T 7: 119,923,803 (GRCm39) N1620I possibly damaging Het
Acap1 A T 11: 69,776,641 (GRCm39) S149T possibly damaging Het
Adgre1 T A 17: 57,751,064 (GRCm39) Y579* probably null Het
Aifm3 T C 16: 17,318,296 (GRCm39) probably benign Het
Aldh16a1 A G 7: 44,791,385 (GRCm39) W107R probably damaging Het
Amer2 A T 14: 60,616,894 (GRCm39) H363L possibly damaging Het
Arhgap10 A G 8: 78,152,957 (GRCm39) probably null Het
Arhgef6 A T X: 56,280,238 (GRCm39) D742E probably damaging Het
Astn2 A T 4: 65,647,644 (GRCm39) N731K probably damaging Het
Atp1a2 T C 1: 172,105,954 (GRCm39) T904A possibly damaging Het
Atr C T 9: 95,789,352 (GRCm39) R1503W probably damaging Het
Cdh3 G T 8: 107,263,242 (GRCm39) R97L probably benign Het
Chst2 C T 9: 95,288,059 (GRCm39) V96I probably benign Het
Cit T A 5: 116,123,856 (GRCm39) N1464K probably benign Het
Col17a1 A T 19: 47,658,897 (GRCm39) probably null Het
Col4a3 G A 1: 82,688,698 (GRCm39) probably benign Het
Copz1 T A 15: 103,199,757 (GRCm39) S57R probably damaging Het
Cpped1 A T 16: 11,646,143 (GRCm39) F227Y probably damaging Het
Cyp2j12 A T 4: 95,990,388 (GRCm39) probably null Het
Dctn1 T A 6: 83,166,189 (GRCm39) I195N possibly damaging Het
Dhrs7b A G 11: 60,742,751 (GRCm39) I148V probably benign Het
Dnah17 T C 11: 117,918,259 (GRCm39) D4096G probably damaging Het
Dnajc13 T C 9: 104,110,837 (GRCm39) N145D possibly damaging Het
Ecpas A G 4: 58,827,073 (GRCm39) V1020A probably damaging Het
Entrep2 G T 7: 64,409,116 (GRCm39) S426* probably null Het
Ercc6l2 T C 13: 64,042,627 (GRCm39) probably benign Het
Fads6 T G 11: 115,187,387 (GRCm39) I103L probably benign Het
Fat4 T G 3: 39,064,614 (GRCm39) Y4857D probably damaging Het
Fbxl14 T A 6: 119,457,671 (GRCm39) L284Q probably damaging Het
Fkbp9 T C 6: 56,826,655 (GRCm39) V85A possibly damaging Het
Galnt13 T A 2: 54,406,577 (GRCm39) V9E probably damaging Het
Gm14412 A T 2: 177,006,373 (GRCm39) S507R probably benign Het
Gm15142 T A X: 153,421,415 (GRCm39) noncoding transcript Het
Gm4787 T C 12: 81,425,612 (GRCm39) E182G probably benign Het
Gm6811 C A 17: 21,314,893 (GRCm39) noncoding transcript Het
Gm9791 A T 3: 34,059,218 (GRCm39) noncoding transcript Het
Hoxb7 A T 11: 96,180,336 (GRCm39) probably null Het
Ift122 T A 6: 115,892,819 (GRCm39) probably benign Het
Krt28 C T 11: 99,265,458 (GRCm39) V70I probably benign Het
Lig1 T C 7: 13,032,664 (GRCm39) S459P probably damaging Het
Lrfn3 C T 7: 30,060,048 (GRCm39) R59H possibly damaging Het
Mavs T C 2: 131,088,663 (GRCm39) V489A probably benign Het
Mcm8 C T 2: 132,681,399 (GRCm39) P625L probably benign Het
Megf10 G T 18: 57,373,745 (GRCm39) R181L probably benign Het
Mgrn1 G A 16: 4,745,726 (GRCm39) G440D probably benign Het
Mllt3 T C 4: 87,700,642 (GRCm39) probably null Het
Muc5ac T A 7: 141,371,639 (GRCm39) Y2613* probably null Het
Myh14 C T 7: 44,284,926 (GRCm39) G662S probably benign Het
Myod1 T A 7: 46,026,474 (GRCm39) N126K probably damaging Het
Nae1 A T 8: 105,242,774 (GRCm39) H439Q possibly damaging Het
Narf T A 11: 121,135,765 (GRCm39) V136E possibly damaging Het
Ncapd3 T A 9: 26,983,031 (GRCm39) C926* probably null Het
Ndufv2 C A 17: 66,399,653 (GRCm39) probably null Het
Neb T C 2: 52,102,987 (GRCm39) S449G possibly damaging Het
Nek10 C T 14: 14,930,577 (GRCm38) P698L probably damaging Het
Nox3 T A 17: 3,685,550 (GRCm39) E566V probably null Het
Oas1a C T 5: 121,043,787 (GRCm39) R115H probably benign Het
Or10ag60 C A 2: 87,438,487 (GRCm39) L252I probably benign Het
Or51b6 A G 7: 103,555,879 (GRCm39) T78A probably damaging Het
Or5w19 A G 2: 87,698,574 (GRCm39) M80V probably benign Het
Or8k30 T A 2: 86,339,469 (GRCm39) L222H probably damaging Het
Pbld2 A G 10: 62,883,778 (GRCm39) H142R probably damaging Het
Pcdha4 C T 18: 37,087,869 (GRCm39) T684M probably benign Het
Phc3 G T 3: 31,005,068 (GRCm39) T175N probably damaging Het
Pigs G T 11: 78,219,828 (GRCm39) V68L probably damaging Het
Pik3c2g T A 6: 139,913,528 (GRCm39) D857E possibly damaging Het
Pitpnm3 G A 11: 71,953,998 (GRCm39) P550S probably damaging Het
Pla2g15 G A 8: 106,889,850 (GRCm39) W374* probably null Het
Ptpn14 G A 1: 189,554,839 (GRCm39) C133Y probably damaging Het
Ptpn20 A G 14: 33,336,446 (GRCm39) N95S probably benign Het
Ptrh2 G T 11: 86,580,862 (GRCm39) V160F probably damaging Het
Rapgef3 T C 15: 97,655,256 (GRCm39) D486G probably damaging Het
Rev3l T G 10: 39,699,981 (GRCm39) S1493A probably benign Het
Rgs9 T A 11: 109,116,570 (GRCm39) D411V probably benign Het
Rgsl1 A T 1: 153,669,514 (GRCm39) Y291N probably damaging Het
Rprd2 A G 3: 95,671,849 (GRCm39) Y1185H probably damaging Het
Rpusd3 A G 6: 113,393,167 (GRCm39) probably benign Het
Scnn1a T C 6: 125,299,136 (GRCm39) I72T probably damaging Het
Sdk1 A T 5: 141,842,758 (GRCm39) probably benign Het
Sfmbt2 T C 2: 10,450,556 (GRCm39) L277P probably benign Het
Sgf29 A G 7: 126,264,154 (GRCm39) E73G probably damaging Het
Slc12a6 T A 2: 112,183,306 (GRCm39) F764L probably damaging Het
Slc4a2 T C 5: 24,640,340 (GRCm39) probably null Het
Slc9a3 T G 13: 74,305,838 (GRCm39) V285G probably damaging Het
Slc9c1 A G 16: 45,395,772 (GRCm39) T608A probably benign Het
Slfnl1 C T 4: 120,392,882 (GRCm39) R325C probably damaging Het
Smarcad1 T A 6: 65,051,898 (GRCm39) F344I probably benign Het
Snrnp70 A T 7: 45,026,705 (GRCm39) probably null Het
Sod2 C T 17: 13,227,073 (GRCm39) T9M probably benign Het
Spag5 T A 11: 78,205,199 (GRCm39) S633T probably damaging Het
Spta1 A T 1: 174,018,622 (GRCm39) I531L probably benign Het
Stra8 A G 6: 34,910,091 (GRCm39) E60G probably benign Het
Sult2a3 T A 7: 13,845,482 (GRCm39) I126F probably benign Het
Syt1 T C 10: 108,340,373 (GRCm39) H315R possibly damaging Het
Tanc2 T C 11: 105,758,588 (GRCm39) L783P probably damaging Het
Ticam2 T A 18: 46,693,989 (GRCm39) K33* probably null Het
Trim17 T C 11: 58,845,127 (GRCm39) probably benign Het
Tsr1 G A 11: 74,798,705 (GRCm39) M691I probably benign Het
Ttn T A 2: 76,592,763 (GRCm39) I20790F probably damaging Het
Tubb2b A T 13: 34,312,168 (GRCm39) Y208* probably null Het
Ubr1 T A 2: 120,745,419 (GRCm39) I890F probably damaging Het
Usp54 T C 14: 20,612,260 (GRCm39) E852G probably damaging Het
Vmn2r78 T C 7: 86,603,835 (GRCm39) V671A probably damaging Het
Wipi1 T C 11: 109,470,475 (GRCm39) K315E probably benign Het
Xrn2 T C 2: 146,893,638 (GRCm39) V735A possibly damaging Het
Zdbf2 T A 1: 63,347,973 (GRCm39) D2117E possibly damaging Het
Zfp287 A T 11: 62,604,962 (GRCm39) C648* probably null Het
Zfp369 A G 13: 65,444,614 (GRCm39) T586A possibly damaging Het
Other mutations in Thbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Thbs2 APN 17 14,889,097 (GRCm39) missense probably damaging 1.00
IGL00764:Thbs2 APN 17 14,910,514 (GRCm39) missense probably damaging 0.98
IGL01370:Thbs2 APN 17 14,910,327 (GRCm39) missense possibly damaging 0.82
IGL01604:Thbs2 APN 17 14,899,031 (GRCm39) missense probably benign 0.31
IGL01936:Thbs2 APN 17 14,908,076 (GRCm39) missense probably benign 0.00
IGL02061:Thbs2 APN 17 14,900,176 (GRCm39) missense probably benign 0.35
IGL02255:Thbs2 APN 17 14,910,047 (GRCm39) missense probably benign 0.00
IGL02342:Thbs2 APN 17 14,896,578 (GRCm39) missense probably damaging 1.00
IGL02402:Thbs2 APN 17 14,891,716 (GRCm39) missense probably benign 0.01
IGL02499:Thbs2 APN 17 14,904,328 (GRCm39) splice site probably benign
IGL02572:Thbs2 APN 17 14,897,275 (GRCm39) missense possibly damaging 0.72
IGL02701:Thbs2 APN 17 14,903,623 (GRCm39) missense probably benign 0.05
IGL02871:Thbs2 APN 17 14,906,048 (GRCm39) missense probably benign
IGL03058:Thbs2 APN 17 14,910,231 (GRCm39) missense possibly damaging 0.91
IGL03185:Thbs2 APN 17 14,901,672 (GRCm39) nonsense probably null
IGL03232:Thbs2 APN 17 14,911,675 (GRCm39) start codon destroyed probably null
IGL03289:Thbs2 APN 17 14,910,384 (GRCm39) missense probably benign 0.00
IGL03407:Thbs2 APN 17 14,893,535 (GRCm39) missense probably benign 0.00
H8562:Thbs2 UTSW 17 14,891,715 (GRCm39) missense probably benign 0.00
IGL02802:Thbs2 UTSW 17 14,904,389 (GRCm39) missense probably benign 0.01
PIT4354001:Thbs2 UTSW 17 14,910,230 (GRCm39) missense probably damaging 0.99
R0088:Thbs2 UTSW 17 14,901,963 (GRCm39) missense possibly damaging 0.96
R0167:Thbs2 UTSW 17 14,887,787 (GRCm39) splice site probably benign
R0415:Thbs2 UTSW 17 14,900,235 (GRCm39) missense probably benign
R0658:Thbs2 UTSW 17 14,900,587 (GRCm39) missense probably benign 0.00
R0735:Thbs2 UTSW 17 14,900,077 (GRCm39) missense probably benign 0.00
R1582:Thbs2 UTSW 17 14,891,550 (GRCm39) missense probably damaging 1.00
R1585:Thbs2 UTSW 17 14,910,030 (GRCm39) missense probably benign 0.00
R1608:Thbs2 UTSW 17 14,906,043 (GRCm39) missense probably benign
R1721:Thbs2 UTSW 17 14,899,072 (GRCm39) missense probably benign 0.00
R1724:Thbs2 UTSW 17 14,906,162 (GRCm39) missense possibly damaging 0.80
R1791:Thbs2 UTSW 17 14,906,075 (GRCm39) missense probably benign
R1816:Thbs2 UTSW 17 14,890,976 (GRCm39) missense probably benign 0.00
R1816:Thbs2 UTSW 17 14,890,975 (GRCm39) missense probably benign 0.01
R1911:Thbs2 UTSW 17 14,910,104 (GRCm39) missense probably benign 0.38
R2137:Thbs2 UTSW 17 14,893,568 (GRCm39) missense probably damaging 1.00
R2152:Thbs2 UTSW 17 14,893,471 (GRCm39) missense probably damaging 1.00
R2244:Thbs2 UTSW 17 14,891,675 (GRCm39) missense probably damaging 1.00
R2325:Thbs2 UTSW 17 14,910,551 (GRCm39) splice site probably null
R2509:Thbs2 UTSW 17 14,906,105 (GRCm39) missense probably benign 0.11
R3838:Thbs2 UTSW 17 14,908,113 (GRCm39) missense probably benign
R4173:Thbs2 UTSW 17 14,901,893 (GRCm39) splice site probably null
R4427:Thbs2 UTSW 17 14,900,597 (GRCm39) missense probably benign
R4495:Thbs2 UTSW 17 14,891,675 (GRCm39) missense probably damaging 1.00
R4789:Thbs2 UTSW 17 14,891,750 (GRCm39) missense probably damaging 1.00
R5058:Thbs2 UTSW 17 14,896,591 (GRCm39) missense probably damaging 1.00
R5112:Thbs2 UTSW 17 14,890,852 (GRCm39) splice site probably null
R5619:Thbs2 UTSW 17 14,901,506 (GRCm39) missense probably damaging 1.00
R5649:Thbs2 UTSW 17 14,910,215 (GRCm39) missense probably damaging 1.00
R5664:Thbs2 UTSW 17 14,910,099 (GRCm39) missense probably damaging 1.00
R5801:Thbs2 UTSW 17 14,908,125 (GRCm39) missense probably damaging 1.00
R5816:Thbs2 UTSW 17 14,904,333 (GRCm39) critical splice donor site probably null
R5840:Thbs2 UTSW 17 14,901,692 (GRCm39) splice site probably null
R6149:Thbs2 UTSW 17 14,899,942 (GRCm39) critical splice donor site probably null
R6166:Thbs2 UTSW 17 14,900,650 (GRCm39) missense probably damaging 1.00
R6412:Thbs2 UTSW 17 14,897,339 (GRCm39) missense probably damaging 1.00
R6473:Thbs2 UTSW 17 14,906,058 (GRCm39) missense probably benign 0.23
R6640:Thbs2 UTSW 17 14,893,630 (GRCm39) missense possibly damaging 0.94
R6695:Thbs2 UTSW 17 14,894,426 (GRCm39) missense possibly damaging 0.54
R6711:Thbs2 UTSW 17 14,910,527 (GRCm39) missense probably benign 0.00
R6947:Thbs2 UTSW 17 14,910,029 (GRCm39) missense possibly damaging 0.79
R6962:Thbs2 UTSW 17 14,902,082 (GRCm39) missense probably benign 0.00
R7183:Thbs2 UTSW 17 14,910,378 (GRCm39) missense possibly damaging 0.90
R7203:Thbs2 UTSW 17 14,891,720 (GRCm39) missense probably damaging 1.00
R7386:Thbs2 UTSW 17 14,893,412 (GRCm39) missense possibly damaging 0.95
R7621:Thbs2 UTSW 17 14,894,426 (GRCm39) missense probably benign
R7747:Thbs2 UTSW 17 14,890,301 (GRCm39) missense possibly damaging 0.94
R7759:Thbs2 UTSW 17 14,897,321 (GRCm39) missense probably damaging 1.00
R7800:Thbs2 UTSW 17 14,896,558 (GRCm39) missense probably damaging 1.00
R7895:Thbs2 UTSW 17 14,896,483 (GRCm39) missense probably damaging 1.00
R8094:Thbs2 UTSW 17 14,900,584 (GRCm39) missense probably benign 0.00
R8332:Thbs2 UTSW 17 14,900,032 (GRCm39) missense probably damaging 1.00
R8478:Thbs2 UTSW 17 14,900,666 (GRCm39) missense probably benign 0.00
R8695:Thbs2 UTSW 17 14,899,963 (GRCm39) missense probably benign
R8707:Thbs2 UTSW 17 14,911,645 (GRCm39) missense probably damaging 1.00
R9001:Thbs2 UTSW 17 14,889,007 (GRCm39) missense probably damaging 1.00
R9075:Thbs2 UTSW 17 14,900,587 (GRCm39) missense probably benign 0.00
R9183:Thbs2 UTSW 17 14,896,526 (GRCm39) missense probably benign 0.03
R9461:Thbs2 UTSW 17 14,910,435 (GRCm39) missense probably damaging 1.00
R9462:Thbs2 UTSW 17 14,890,243 (GRCm39) missense probably damaging 1.00
R9536:Thbs2 UTSW 17 14,910,147 (GRCm39) missense probably damaging 1.00
R9592:Thbs2 UTSW 17 14,899,083 (GRCm39) missense probably damaging 1.00
S24628:Thbs2 UTSW 17 14,900,235 (GRCm39) missense probably benign
X0025:Thbs2 UTSW 17 14,902,062 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCACACACCAGGTTGTTGTTG -3'
(R):5'- ATGGCAAGCAGTGTTACACAAC -3'

Sequencing Primer
(F):5'- TTGTTGGGCCAGCCATC -3'
(R):5'- AGCAGTGTTACACAACAAGTTC -3'
Posted On 2016-04-15