Incidental Mutation 'R4928:Adgre1'
ID 381054
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Name adhesion G protein-coupled receptor E1
Synonyms DD7A5-7, EGF-TM7, Emr1, Ly71, F4/80, TM7LN3
MMRRC Submission 042529-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.188) question?
Stock # R4928 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 57665691-57790527 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 57751064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 579 (Y579*)
Ref Sequence ENSEMBL: ENSMUSP00000083971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
AlphaFold Q61549
Predicted Effect probably null
Transcript: ENSMUST00000004850
AA Change: Y579*
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: Y579*

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086763
AA Change: Y579*
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: Y579*

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 82,805,086 (GRCm39) noncoding transcript Het
Aasdh T A 5: 77,044,535 (GRCm39) K118N possibly damaging Het
Abca14 A T 7: 119,923,803 (GRCm39) N1620I possibly damaging Het
Acap1 A T 11: 69,776,641 (GRCm39) S149T possibly damaging Het
Aifm3 T C 16: 17,318,296 (GRCm39) probably benign Het
Aldh16a1 A G 7: 44,791,385 (GRCm39) W107R probably damaging Het
Amer2 A T 14: 60,616,894 (GRCm39) H363L possibly damaging Het
Arhgap10 A G 8: 78,152,957 (GRCm39) probably null Het
Arhgef6 A T X: 56,280,238 (GRCm39) D742E probably damaging Het
Astn2 A T 4: 65,647,644 (GRCm39) N731K probably damaging Het
Atp1a2 T C 1: 172,105,954 (GRCm39) T904A possibly damaging Het
Atr C T 9: 95,789,352 (GRCm39) R1503W probably damaging Het
Cdh3 G T 8: 107,263,242 (GRCm39) R97L probably benign Het
Chst2 C T 9: 95,288,059 (GRCm39) V96I probably benign Het
Cit T A 5: 116,123,856 (GRCm39) N1464K probably benign Het
Col17a1 A T 19: 47,658,897 (GRCm39) probably null Het
Col4a3 G A 1: 82,688,698 (GRCm39) probably benign Het
Copz1 T A 15: 103,199,757 (GRCm39) S57R probably damaging Het
Cpped1 A T 16: 11,646,143 (GRCm39) F227Y probably damaging Het
Cyp2j12 A T 4: 95,990,388 (GRCm39) probably null Het
Dctn1 T A 6: 83,166,189 (GRCm39) I195N possibly damaging Het
Dhrs7b A G 11: 60,742,751 (GRCm39) I148V probably benign Het
Dnah17 T C 11: 117,918,259 (GRCm39) D4096G probably damaging Het
Dnajc13 T C 9: 104,110,837 (GRCm39) N145D possibly damaging Het
Ecpas A G 4: 58,827,073 (GRCm39) V1020A probably damaging Het
Entrep2 G T 7: 64,409,116 (GRCm39) S426* probably null Het
Ercc6l2 T C 13: 64,042,627 (GRCm39) probably benign Het
Fads6 T G 11: 115,187,387 (GRCm39) I103L probably benign Het
Fat4 T G 3: 39,064,614 (GRCm39) Y4857D probably damaging Het
Fbxl14 T A 6: 119,457,671 (GRCm39) L284Q probably damaging Het
Fkbp9 T C 6: 56,826,655 (GRCm39) V85A possibly damaging Het
Galnt13 T A 2: 54,406,577 (GRCm39) V9E probably damaging Het
Gm14412 A T 2: 177,006,373 (GRCm39) S507R probably benign Het
Gm15142 T A X: 153,421,415 (GRCm39) noncoding transcript Het
Gm4787 T C 12: 81,425,612 (GRCm39) E182G probably benign Het
Gm6811 C A 17: 21,314,893 (GRCm39) noncoding transcript Het
Gm9791 A T 3: 34,059,218 (GRCm39) noncoding transcript Het
Hoxb7 A T 11: 96,180,336 (GRCm39) probably null Het
Ift122 T A 6: 115,892,819 (GRCm39) probably benign Het
Krt28 C T 11: 99,265,458 (GRCm39) V70I probably benign Het
Lig1 T C 7: 13,032,664 (GRCm39) S459P probably damaging Het
Lrfn3 C T 7: 30,060,048 (GRCm39) R59H possibly damaging Het
Mavs T C 2: 131,088,663 (GRCm39) V489A probably benign Het
Mcm8 C T 2: 132,681,399 (GRCm39) P625L probably benign Het
Megf10 G T 18: 57,373,745 (GRCm39) R181L probably benign Het
Mgrn1 G A 16: 4,745,726 (GRCm39) G440D probably benign Het
Mllt3 T C 4: 87,700,642 (GRCm39) probably null Het
Muc5ac T A 7: 141,371,639 (GRCm39) Y2613* probably null Het
Myh14 C T 7: 44,284,926 (GRCm39) G662S probably benign Het
Myod1 T A 7: 46,026,474 (GRCm39) N126K probably damaging Het
Nae1 A T 8: 105,242,774 (GRCm39) H439Q possibly damaging Het
Narf T A 11: 121,135,765 (GRCm39) V136E possibly damaging Het
Ncapd3 T A 9: 26,983,031 (GRCm39) C926* probably null Het
Ndufv2 C A 17: 66,399,653 (GRCm39) probably null Het
Neb T C 2: 52,102,987 (GRCm39) S449G possibly damaging Het
Nek10 C T 14: 14,930,577 (GRCm38) P698L probably damaging Het
Nox3 T A 17: 3,685,550 (GRCm39) E566V probably null Het
Oas1a C T 5: 121,043,787 (GRCm39) R115H probably benign Het
Or10ag60 C A 2: 87,438,487 (GRCm39) L252I probably benign Het
Or51b6 A G 7: 103,555,879 (GRCm39) T78A probably damaging Het
Or5w19 A G 2: 87,698,574 (GRCm39) M80V probably benign Het
Or8k30 T A 2: 86,339,469 (GRCm39) L222H probably damaging Het
Pbld2 A G 10: 62,883,778 (GRCm39) H142R probably damaging Het
Pcdha4 C T 18: 37,087,869 (GRCm39) T684M probably benign Het
Phc3 G T 3: 31,005,068 (GRCm39) T175N probably damaging Het
Pigs G T 11: 78,219,828 (GRCm39) V68L probably damaging Het
Pik3c2g T A 6: 139,913,528 (GRCm39) D857E possibly damaging Het
Pitpnm3 G A 11: 71,953,998 (GRCm39) P550S probably damaging Het
Pla2g15 G A 8: 106,889,850 (GRCm39) W374* probably null Het
Ptpn14 G A 1: 189,554,839 (GRCm39) C133Y probably damaging Het
Ptpn20 A G 14: 33,336,446 (GRCm39) N95S probably benign Het
Ptrh2 G T 11: 86,580,862 (GRCm39) V160F probably damaging Het
Rapgef3 T C 15: 97,655,256 (GRCm39) D486G probably damaging Het
Rev3l T G 10: 39,699,981 (GRCm39) S1493A probably benign Het
Rgs9 T A 11: 109,116,570 (GRCm39) D411V probably benign Het
Rgsl1 A T 1: 153,669,514 (GRCm39) Y291N probably damaging Het
Rprd2 A G 3: 95,671,849 (GRCm39) Y1185H probably damaging Het
Rpusd3 A G 6: 113,393,167 (GRCm39) probably benign Het
Scnn1a T C 6: 125,299,136 (GRCm39) I72T probably damaging Het
Sdk1 A T 5: 141,842,758 (GRCm39) probably benign Het
Sfmbt2 T C 2: 10,450,556 (GRCm39) L277P probably benign Het
Sgf29 A G 7: 126,264,154 (GRCm39) E73G probably damaging Het
Slc12a6 T A 2: 112,183,306 (GRCm39) F764L probably damaging Het
Slc4a2 T C 5: 24,640,340 (GRCm39) probably null Het
Slc9a3 T G 13: 74,305,838 (GRCm39) V285G probably damaging Het
Slc9c1 A G 16: 45,395,772 (GRCm39) T608A probably benign Het
Slfnl1 C T 4: 120,392,882 (GRCm39) R325C probably damaging Het
Smarcad1 T A 6: 65,051,898 (GRCm39) F344I probably benign Het
Snrnp70 A T 7: 45,026,705 (GRCm39) probably null Het
Sod2 C T 17: 13,227,073 (GRCm39) T9M probably benign Het
Spag5 T A 11: 78,205,199 (GRCm39) S633T probably damaging Het
Spta1 A T 1: 174,018,622 (GRCm39) I531L probably benign Het
Stra8 A G 6: 34,910,091 (GRCm39) E60G probably benign Het
Sult2a3 T A 7: 13,845,482 (GRCm39) I126F probably benign Het
Syt1 T C 10: 108,340,373 (GRCm39) H315R possibly damaging Het
Tanc2 T C 11: 105,758,588 (GRCm39) L783P probably damaging Het
Thbs2 C T 17: 14,899,162 (GRCm39) C646Y probably damaging Het
Ticam2 T A 18: 46,693,989 (GRCm39) K33* probably null Het
Trim17 T C 11: 58,845,127 (GRCm39) probably benign Het
Tsr1 G A 11: 74,798,705 (GRCm39) M691I probably benign Het
Ttn T A 2: 76,592,763 (GRCm39) I20790F probably damaging Het
Tubb2b A T 13: 34,312,168 (GRCm39) Y208* probably null Het
Ubr1 T A 2: 120,745,419 (GRCm39) I890F probably damaging Het
Usp54 T C 14: 20,612,260 (GRCm39) E852G probably damaging Het
Vmn2r78 T C 7: 86,603,835 (GRCm39) V671A probably damaging Het
Wipi1 T C 11: 109,470,475 (GRCm39) K315E probably benign Het
Xrn2 T C 2: 146,893,638 (GRCm39) V735A possibly damaging Het
Zdbf2 T A 1: 63,347,973 (GRCm39) D2117E possibly damaging Het
Zfp287 A T 11: 62,604,962 (GRCm39) C648* probably null Het
Zfp369 A G 13: 65,444,614 (GRCm39) T586A possibly damaging Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57,757,055 (GRCm39) missense probably benign 0.00
IGL00966:Adgre1 APN 17 57,726,335 (GRCm39) missense probably benign 0.04
IGL01680:Adgre1 APN 17 57,709,620 (GRCm39) missense unknown
IGL01724:Adgre1 APN 17 57,751,064 (GRCm39) nonsense probably null
IGL02172:Adgre1 APN 17 57,785,879 (GRCm39) missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57,754,891 (GRCm39) missense probably benign 0.01
IGL02272:Adgre1 APN 17 57,757,021 (GRCm39) nonsense probably null
IGL02336:Adgre1 APN 17 57,718,024 (GRCm39) nonsense probably null
IGL02346:Adgre1 APN 17 57,750,919 (GRCm39) missense probably benign 0.15
IGL02398:Adgre1 APN 17 57,709,824 (GRCm39) nonsense probably null
IGL02618:Adgre1 APN 17 57,751,021 (GRCm39) missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57,787,921 (GRCm39) missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57,785,833 (GRCm39) missense probably benign 0.26
IGL03112:Adgre1 APN 17 57,755,029 (GRCm39) splice site probably null
IGL03350:Adgre1 APN 17 57,708,908 (GRCm39) missense probably benign 0.16
F480 UTSW 17 57,751,063 (GRCm39) missense probably damaging 1.00
lomax UTSW 17 57,709,811 (GRCm39) missense unknown
Onion UTSW 17 57,709,841 (GRCm39) nonsense probably null
Scallion UTSW 17 57,708,977 (GRCm39) missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57,709,841 (GRCm39) nonsense probably null
R0153:Adgre1 UTSW 17 57,750,939 (GRCm39) missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57,751,060 (GRCm39) missense probably benign 0.00
R0278:Adgre1 UTSW 17 57,754,872 (GRCm39) missense probably benign 0.07
R0323:Adgre1 UTSW 17 57,751,060 (GRCm39) missense probably benign 0.00
R0389:Adgre1 UTSW 17 57,713,839 (GRCm39) missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57,709,742 (GRCm39) missense unknown
R0621:Adgre1 UTSW 17 57,748,359 (GRCm39) missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57,718,003 (GRCm39) missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57,754,936 (GRCm39) missense probably benign 0.00
R1601:Adgre1 UTSW 17 57,748,353 (GRCm39) missense probably benign 0.01
R1689:Adgre1 UTSW 17 57,756,921 (GRCm39) missense probably benign 0.31
R1708:Adgre1 UTSW 17 57,708,974 (GRCm39) missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57,748,350 (GRCm39) missense probably benign 0.43
R1839:Adgre1 UTSW 17 57,748,299 (GRCm39) missense probably benign 0.00
R1860:Adgre1 UTSW 17 57,748,363 (GRCm39) missense probably benign 0.00
R2165:Adgre1 UTSW 17 57,726,338 (GRCm39) missense probably damaging 0.97
R2219:Adgre1 UTSW 17 57,708,912 (GRCm39) missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57,717,956 (GRCm39) missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57,708,925 (GRCm39) missense probably benign 0.08
R3911:Adgre1 UTSW 17 57,754,860 (GRCm39) missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57,709,811 (GRCm39) missense unknown
R4439:Adgre1 UTSW 17 57,754,954 (GRCm39) missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57,717,947 (GRCm39) missense probably benign 0.34
R4529:Adgre1 UTSW 17 57,727,519 (GRCm39) missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57,713,874 (GRCm39) missense probably benign 0.07
R4610:Adgre1 UTSW 17 57,757,073 (GRCm39) missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57,787,947 (GRCm39) missense probably benign 0.20
R4911:Adgre1 UTSW 17 57,754,832 (GRCm39) missense possibly damaging 0.57
R4942:Adgre1 UTSW 17 57,713,903 (GRCm39) missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57,750,918 (GRCm39) missense probably benign 0.33
R4953:Adgre1 UTSW 17 57,748,321 (GRCm39) missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57,708,977 (GRCm39) missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57,709,817 (GRCm39) missense probably benign 0.39
R5590:Adgre1 UTSW 17 57,752,034 (GRCm39) missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57,727,437 (GRCm39) missense probably benign 0.15
R5699:Adgre1 UTSW 17 57,788,007 (GRCm39) missense probably benign 0.43
R5734:Adgre1 UTSW 17 57,750,990 (GRCm39) missense probably benign 0.00
R5860:Adgre1 UTSW 17 57,752,034 (GRCm39) missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57,713,859 (GRCm39) missense probably benign 0.28
R6039:Adgre1 UTSW 17 57,713,859 (GRCm39) missense probably benign 0.28
R6149:Adgre1 UTSW 17 57,752,018 (GRCm39) missense probably benign 0.08
R6478:Adgre1 UTSW 17 57,708,955 (GRCm39) missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57,713,917 (GRCm39) missense probably benign 0.10
R6864:Adgre1 UTSW 17 57,785,879 (GRCm39) missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57,727,399 (GRCm39) missense probably benign 0.39
R6945:Adgre1 UTSW 17 57,717,844 (GRCm39) missense probably benign 0.01
R6988:Adgre1 UTSW 17 57,715,445 (GRCm39) missense probably benign 0.00
R7019:Adgre1 UTSW 17 57,717,945 (GRCm39) missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57,751,087 (GRCm39) splice site probably null
R7347:Adgre1 UTSW 17 57,727,441 (GRCm39) missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57,756,933 (GRCm39) missense probably damaging 1.00
R7709:Adgre1 UTSW 17 57,709,519 (GRCm39) missense unknown
R7939:Adgre1 UTSW 17 57,756,938 (GRCm39) missense probably damaging 0.98
R7977:Adgre1 UTSW 17 57,754,987 (GRCm39) missense possibly damaging 0.54
R7987:Adgre1 UTSW 17 57,754,987 (GRCm39) missense possibly damaging 0.54
R8187:Adgre1 UTSW 17 57,727,349 (GRCm39) missense probably benign 0.00
R8210:Adgre1 UTSW 17 57,752,061 (GRCm39) missense possibly damaging 0.94
R8223:Adgre1 UTSW 17 57,668,692 (GRCm39) missense probably damaging 0.99
R8344:Adgre1 UTSW 17 57,715,459 (GRCm39) missense probably benign 0.12
R8698:Adgre1 UTSW 17 57,709,003 (GRCm39) missense probably benign 0.05
R9236:Adgre1 UTSW 17 57,709,782 (GRCm39) nonsense probably null
R9262:Adgre1 UTSW 17 57,754,941 (GRCm39) missense probably damaging 1.00
R9303:Adgre1 UTSW 17 57,748,275 (GRCm39) missense probably benign 0.00
R9305:Adgre1 UTSW 17 57,748,275 (GRCm39) missense probably benign 0.00
R9605:Adgre1 UTSW 17 57,718,083 (GRCm39) missense probably benign 0.00
R9661:Adgre1 UTSW 17 57,748,368 (GRCm39) missense possibly damaging 0.70
R9678:Adgre1 UTSW 17 57,750,997 (GRCm39) missense probably damaging 0.96
R9751:Adgre1 UTSW 17 57,757,101 (GRCm39) missense probably null 0.06
R9785:Adgre1 UTSW 17 57,785,930 (GRCm39) missense probably damaging 1.00
Z1176:Adgre1 UTSW 17 57,668,729 (GRCm39) missense possibly damaging 0.76
Z1177:Adgre1 UTSW 17 57,726,374 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCATGAGTGTACACATGTTGC -3'
(R):5'- GCACACAGCATCTCTCTAGTAAAG -3'

Sequencing Primer
(F):5'- ACACATGTTGCTGTGTGTACAC -3'
(R):5'- GCATCTCTCTAGTAAAGGAAAAATGG -3'
Posted On 2016-04-15