Incidental Mutation 'R4928:Ndufv2'
ID381055
Institutional Source Beutler Lab
Gene Symbol Ndufv2
Ensembl Gene ENSMUSG00000024099
Gene NameNADH dehydrogenase (ubiquinone) flavoprotein 2
Synonyms
MMRRC Submission 042529-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4928 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location66078795-66101559 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 66092658 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024909] [ENSMUST00000138847] [ENSMUST00000143987] [ENSMUST00000147484]
Predicted Effect probably benign
Transcript: ENSMUST00000024909
SMART Domains Protein: ENSMUSP00000024909
Gene: ENSMUSG00000024099

DomainStartEndE-ValueType
Pfam:2Fe-2S_thioredx 1 112 1.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138847
SMART Domains Protein: ENSMUSP00000137940
Gene: ENSMUSG00000024099

DomainStartEndE-ValueType
Pfam:2Fe-2S_thioredx 1 59 8.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143987
SMART Domains Protein: ENSMUSP00000121557
Gene: ENSMUSG00000024099

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:2Fe-2S_thioredx 62 208 1.2e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147484
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. This gene is a core subunit and is conserved in prokaryotes and eukaryotes. The bovine ortholog of this protein has been characterized and is reported to contain an iron-sulfur cluster, which may be involved in electron transfer. In humans mutations in this gene are implicated in Parkinson's disease, bipolar disorder, schizophrenia, and have been found in one case of early onset hypertrophic cardiomyopathy and encephalopathy. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a transposon induced allele may exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 83,155,878 noncoding transcript Het
Aasdh T A 5: 76,896,688 K118N possibly damaging Het
Abca14 A T 7: 120,324,580 N1620I possibly damaging Het
Acap1 A T 11: 69,885,815 S149T possibly damaging Het
Adgre1 T A 17: 57,444,064 Y579* probably null Het
AI314180 A G 4: 58,827,073 V1020A probably damaging Het
Aifm3 T C 16: 17,500,432 probably benign Het
Aldh16a1 A G 7: 45,141,961 W107R probably damaging Het
Amer2 A T 14: 60,379,445 H363L possibly damaging Het
Arhgap10 A G 8: 77,426,328 probably null Het
Arhgef6 A T X: 57,234,878 D742E probably damaging Het
Astn2 A T 4: 65,729,407 N731K probably damaging Het
Atp1a2 T C 1: 172,278,387 T904A possibly damaging Het
Atr C T 9: 95,907,299 R1503W probably damaging Het
Cdh3 G T 8: 106,536,610 R97L probably benign Het
Chst2 C T 9: 95,406,006 V96I probably benign Het
Cit T A 5: 115,985,797 N1464K probably benign Het
Col17a1 A T 19: 47,670,458 probably null Het
Col4a3 G A 1: 82,710,977 probably benign Het
Copz1 T A 15: 103,291,330 S57R probably damaging Het
Cpped1 A T 16: 11,828,279 F227Y probably damaging Het
Cyp2j12 A T 4: 96,102,151 probably null Het
Dctn1 T A 6: 83,189,207 I195N possibly damaging Het
Dhrs7b A G 11: 60,851,925 I148V probably benign Het
Dnah17 T C 11: 118,027,433 D4096G probably damaging Het
Dnajc13 T C 9: 104,233,638 N145D possibly damaging Het
Ercc6l2 T C 13: 63,894,813 probably benign Het
Fads6 T G 11: 115,296,561 I103L probably benign Het
Fam189a1 G T 7: 64,759,368 S426* probably null Het
Fat4 T G 3: 39,010,465 Y4857D probably damaging Het
Fbxl14 T A 6: 119,480,710 L284Q probably damaging Het
Fkbp9 T C 6: 56,849,670 V85A possibly damaging Het
Galnt13 T A 2: 54,516,565 V9E probably damaging Het
Gm14412 A T 2: 177,314,580 S507R probably benign Het
Gm15142 T A X: 154,638,419 noncoding transcript Het
Gm4787 T C 12: 81,378,838 E182G probably benign Het
Gm6811 C A 17: 21,094,631 noncoding transcript Het
Gm9791 A T 3: 34,005,069 noncoding transcript Het
Hoxb7 A T 11: 96,289,510 probably null Het
Ift122 T A 6: 115,915,858 probably benign Het
Krt28 C T 11: 99,374,632 V70I probably benign Het
Lig1 T C 7: 13,298,738 S459P probably damaging Het
Lrfn3 C T 7: 30,360,623 R59H possibly damaging Het
Mavs T C 2: 131,246,743 V489A probably benign Het
Mcm8 C T 2: 132,839,479 P625L probably benign Het
Megf10 G T 18: 57,240,673 R181L probably benign Het
Mgrn1 G A 16: 4,927,862 G440D probably benign Het
Mllt3 T C 4: 87,782,405 probably null Het
Muc5ac T A 7: 141,817,902 Y2613* probably null Het
Myh14 C T 7: 44,635,502 G662S probably benign Het
Myod1 T A 7: 46,377,050 N126K probably damaging Het
Nae1 A T 8: 104,516,142 H439Q possibly damaging Het
Narf T A 11: 121,244,939 V136E possibly damaging Het
Ncapd3 T A 9: 27,071,735 C926* probably null Het
Neb T C 2: 52,212,975 S449G possibly damaging Het
Nek10 C T 14: 14,930,577 P698L probably damaging Het
Nox3 T A 17: 3,635,275 E566V probably null Het
Oas1a C T 5: 120,905,724 R115H probably benign Het
Olfr1076 T A 2: 86,509,125 L222H probably damaging Het
Olfr1130 C A 2: 87,608,143 L252I probably benign Het
Olfr1152 A G 2: 87,868,230 M80V probably benign Het
Olfr65 A G 7: 103,906,672 T78A probably damaging Het
Pbld2 A G 10: 63,047,999 H142R probably damaging Het
Pcdha4 C T 18: 36,954,816 T684M probably benign Het
Phc3 G T 3: 30,950,919 T175N probably damaging Het
Pigs G T 11: 78,329,002 V68L probably damaging Het
Pik3c2g T A 6: 139,967,802 D857E possibly damaging Het
Pitpnm3 G A 11: 72,063,172 P550S probably damaging Het
Pla2g15 G A 8: 106,163,218 W374* probably null Het
Ptpn14 G A 1: 189,822,642 C133Y probably damaging Het
Ptpn20 A G 14: 33,614,489 N95S probably benign Het
Ptrh2 G T 11: 86,690,036 V160F probably damaging Het
Rapgef3 T C 15: 97,757,375 D486G probably damaging Het
Rev3l T G 10: 39,823,985 S1493A probably benign Het
Rgs9 T A 11: 109,225,744 D411V probably benign Het
Rgsl1 A T 1: 153,793,768 Y291N probably damaging Het
Rprd2 A G 3: 95,764,537 Y1185H probably damaging Het
Rpusd3 A G 6: 113,416,206 probably benign Het
Scnn1a T C 6: 125,322,173 I72T probably damaging Het
Sdk1 A T 5: 141,857,003 probably benign Het
Sfmbt2 T C 2: 10,445,745 L277P probably benign Het
Sgf29 A G 7: 126,664,982 E73G probably damaging Het
Slc12a6 T A 2: 112,352,961 F764L probably damaging Het
Slc4a2 T C 5: 24,435,342 probably null Het
Slc9a3 T G 13: 74,157,719 V285G probably damaging Het
Slc9c1 A G 16: 45,575,409 T608A probably benign Het
Slfnl1 C T 4: 120,535,685 R325C probably damaging Het
Smarcad1 T A 6: 65,074,914 F344I probably benign Het
Snrnp70 A T 7: 45,377,281 probably null Het
Sod2 C T 17: 13,008,186 T9M probably benign Het
Spag5 T A 11: 78,314,373 S633T probably damaging Het
Spta1 A T 1: 174,191,056 I531L probably benign Het
Stra8 A G 6: 34,933,156 E60G probably benign Het
Sult2a3 T A 7: 14,111,557 I126F probably benign Het
Syt1 T C 10: 108,504,512 H315R possibly damaging Het
Tanc2 T C 11: 105,867,762 L783P probably damaging Het
Thbs2 C T 17: 14,678,900 C646Y probably damaging Het
Ticam2 T A 18: 46,560,922 K33* probably null Het
Trim17 T C 11: 58,954,301 probably benign Het
Tsr1 G A 11: 74,907,879 M691I probably benign Het
Ttn T A 2: 76,762,419 I20790F probably damaging Het
Tubb2b A T 13: 34,128,185 Y208* probably null Het
Ubr1 T A 2: 120,914,938 I890F probably damaging Het
Usp54 T C 14: 20,562,192 E852G probably damaging Het
Vmn2r78 T C 7: 86,954,627 V671A probably damaging Het
Wipi1 T C 11: 109,579,649 K315E probably benign Het
Xrn2 T C 2: 147,051,718 V735A possibly damaging Het
Zdbf2 T A 1: 63,308,814 D2117E possibly damaging Het
Zfp287 A T 11: 62,714,136 C648* probably null Het
Zfp369 A G 13: 65,296,800 T586A possibly damaging Het
Other mutations in Ndufv2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Ndufv2 APN 17 66089471 missense possibly damaging 0.95
IGL02445:Ndufv2 APN 17 66080894 unclassified probably benign
IGL03293:Ndufv2 APN 17 66083449 nonsense probably null
golden_loop UTSW 17 66101078 intron probably benign
R0326:Ndufv2 UTSW 17 66080821 missense probably damaging 1.00
R0765:Ndufv2 UTSW 17 66101078 intron probably benign
R1800:Ndufv2 UTSW 17 66083486 missense probably damaging 1.00
R5217:Ndufv2 UTSW 17 66087429 missense probably damaging 1.00
R7475:Ndufv2 UTSW 17 66087537 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTGTCACAGCTATGCACAAATAGTC -3'
(R):5'- GCACTTAGTCTCTCTGGTAGCC -3'

Sequencing Primer
(F):5'- GATAGAGTCTCTATATGTAGCCCAAG -3'
(R):5'- TGGTAGCCAGTCCCATGCTTG -3'
Posted On2016-04-15