Incidental Mutation 'R4928:Col17a1'
ID381060
Institutional Source Beutler Lab
Gene Symbol Col17a1
Ensembl Gene ENSMUSG00000025064
Gene Namecollagen, type XVII, alpha 1
SynonymsBP180, Bpag2, BPAg2, Bpag
MMRRC Submission 042529-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4928 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47646344-47692094 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 47670458 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026045] [ENSMUST00000026045] [ENSMUST00000086923] [ENSMUST00000086923] [ENSMUST00000086923]
Predicted Effect probably null
Transcript: ENSMUST00000026045
SMART Domains Protein: ENSMUSP00000026045
Gene: ENSMUSG00000025064

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.2e-10 PFAM
low complexity region 634 651 N/A INTRINSIC
low complexity region 657 693 N/A INTRINSIC
internal_repeat_4 695 714 1.12e-5 PROSPERO
internal_repeat_3 695 723 3.81e-6 PROSPERO
internal_repeat_1 709 735 1.93e-9 PROSPERO
internal_repeat_4 719 738 1.12e-5 PROSPERO
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1201 1217 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1337 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Pfam:Collagen 1408 1462 3.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000026045
SMART Domains Protein: ENSMUSP00000026045
Gene: ENSMUSG00000025064

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.2e-10 PFAM
low complexity region 634 651 N/A INTRINSIC
low complexity region 657 693 N/A INTRINSIC
internal_repeat_4 695 714 1.12e-5 PROSPERO
internal_repeat_3 695 723 3.81e-6 PROSPERO
internal_repeat_1 709 735 1.93e-9 PROSPERO
internal_repeat_4 719 738 1.12e-5 PROSPERO
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1201 1217 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1337 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Pfam:Collagen 1408 1462 3.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086923
SMART Domains Protein: ENSMUSP00000084141
Gene: ENSMUSG00000025064

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.1e-10 PFAM
Pfam:Collagen 647 726 5.2e-7 PFAM
Pfam:Collagen 699 772 1.8e-9 PFAM
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1164 1180 N/A INTRINSIC
low complexity region 1215 1229 N/A INTRINSIC
low complexity region 1238 1300 N/A INTRINSIC
low complexity region 1338 1348 N/A INTRINSIC
Pfam:Collagen 1371 1425 3.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086923
SMART Domains Protein: ENSMUSP00000084141
Gene: ENSMUSG00000025064

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.1e-10 PFAM
Pfam:Collagen 647 726 5.2e-7 PFAM
Pfam:Collagen 699 772 1.8e-9 PFAM
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1164 1180 N/A INTRINSIC
low complexity region 1215 1229 N/A INTRINSIC
low complexity region 1238 1300 N/A INTRINSIC
low complexity region 1338 1348 N/A INTRINSIC
Pfam:Collagen 1371 1425 3.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086923
SMART Domains Protein: ENSMUSP00000084141
Gene: ENSMUSG00000025064

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.1e-10 PFAM
Pfam:Collagen 647 726 5.2e-7 PFAM
Pfam:Collagen 699 772 1.8e-9 PFAM
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1164 1180 N/A INTRINSIC
low complexity region 1215 1229 N/A INTRINSIC
low complexity region 1238 1300 N/A INTRINSIC
low complexity region 1338 1348 N/A INTRINSIC
Pfam:Collagen 1371 1425 3.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145254
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 83,155,878 noncoding transcript Het
Aasdh T A 5: 76,896,688 K118N possibly damaging Het
Abca14 A T 7: 120,324,580 N1620I possibly damaging Het
Acap1 A T 11: 69,885,815 S149T possibly damaging Het
Adgre1 T A 17: 57,444,064 Y579* probably null Het
AI314180 A G 4: 58,827,073 V1020A probably damaging Het
Aifm3 T C 16: 17,500,432 probably benign Het
Aldh16a1 A G 7: 45,141,961 W107R probably damaging Het
Amer2 A T 14: 60,379,445 H363L possibly damaging Het
Arhgap10 A G 8: 77,426,328 probably null Het
Arhgef6 A T X: 57,234,878 D742E probably damaging Het
Astn2 A T 4: 65,729,407 N731K probably damaging Het
Atp1a2 T C 1: 172,278,387 T904A possibly damaging Het
Atr C T 9: 95,907,299 R1503W probably damaging Het
Cdh3 G T 8: 106,536,610 R97L probably benign Het
Chst2 C T 9: 95,406,006 V96I probably benign Het
Cit T A 5: 115,985,797 N1464K probably benign Het
Col4a3 G A 1: 82,710,977 probably benign Het
Copz1 T A 15: 103,291,330 S57R probably damaging Het
Cpped1 A T 16: 11,828,279 F227Y probably damaging Het
Cyp2j12 A T 4: 96,102,151 probably null Het
Dctn1 T A 6: 83,189,207 I195N possibly damaging Het
Dhrs7b A G 11: 60,851,925 I148V probably benign Het
Dnah17 T C 11: 118,027,433 D4096G probably damaging Het
Dnajc13 T C 9: 104,233,638 N145D possibly damaging Het
Ercc6l2 T C 13: 63,894,813 probably benign Het
Fads6 T G 11: 115,296,561 I103L probably benign Het
Fam189a1 G T 7: 64,759,368 S426* probably null Het
Fat4 T G 3: 39,010,465 Y4857D probably damaging Het
Fbxl14 T A 6: 119,480,710 L284Q probably damaging Het
Fkbp9 T C 6: 56,849,670 V85A possibly damaging Het
Galnt13 T A 2: 54,516,565 V9E probably damaging Het
Gm14412 A T 2: 177,314,580 S507R probably benign Het
Gm15142 T A X: 154,638,419 noncoding transcript Het
Gm4787 T C 12: 81,378,838 E182G probably benign Het
Gm6811 C A 17: 21,094,631 noncoding transcript Het
Gm9791 A T 3: 34,005,069 noncoding transcript Het
Hoxb7 A T 11: 96,289,510 probably null Het
Ift122 T A 6: 115,915,858 probably benign Het
Krt28 C T 11: 99,374,632 V70I probably benign Het
Lig1 T C 7: 13,298,738 S459P probably damaging Het
Lrfn3 C T 7: 30,360,623 R59H possibly damaging Het
Mavs T C 2: 131,246,743 V489A probably benign Het
Mcm8 C T 2: 132,839,479 P625L probably benign Het
Megf10 G T 18: 57,240,673 R181L probably benign Het
Mgrn1 G A 16: 4,927,862 G440D probably benign Het
Mllt3 T C 4: 87,782,405 probably null Het
Muc5ac T A 7: 141,817,902 Y2613* probably null Het
Myh14 C T 7: 44,635,502 G662S probably benign Het
Myod1 T A 7: 46,377,050 N126K probably damaging Het
Nae1 A T 8: 104,516,142 H439Q possibly damaging Het
Narf T A 11: 121,244,939 V136E possibly damaging Het
Ncapd3 T A 9: 27,071,735 C926* probably null Het
Ndufv2 C A 17: 66,092,658 probably null Het
Neb T C 2: 52,212,975 S449G possibly damaging Het
Nek10 C T 14: 14,930,577 P698L probably damaging Het
Nox3 T A 17: 3,635,275 E566V probably null Het
Oas1a C T 5: 120,905,724 R115H probably benign Het
Olfr1076 T A 2: 86,509,125 L222H probably damaging Het
Olfr1130 C A 2: 87,608,143 L252I probably benign Het
Olfr1152 A G 2: 87,868,230 M80V probably benign Het
Olfr65 A G 7: 103,906,672 T78A probably damaging Het
Pbld2 A G 10: 63,047,999 H142R probably damaging Het
Pcdha4 C T 18: 36,954,816 T684M probably benign Het
Phc3 G T 3: 30,950,919 T175N probably damaging Het
Pigs G T 11: 78,329,002 V68L probably damaging Het
Pik3c2g T A 6: 139,967,802 D857E possibly damaging Het
Pitpnm3 G A 11: 72,063,172 P550S probably damaging Het
Pla2g15 G A 8: 106,163,218 W374* probably null Het
Ptpn14 G A 1: 189,822,642 C133Y probably damaging Het
Ptpn20 A G 14: 33,614,489 N95S probably benign Het
Ptrh2 G T 11: 86,690,036 V160F probably damaging Het
Rapgef3 T C 15: 97,757,375 D486G probably damaging Het
Rev3l T G 10: 39,823,985 S1493A probably benign Het
Rgs9 T A 11: 109,225,744 D411V probably benign Het
Rgsl1 A T 1: 153,793,768 Y291N probably damaging Het
Rprd2 A G 3: 95,764,537 Y1185H probably damaging Het
Rpusd3 A G 6: 113,416,206 probably benign Het
Scnn1a T C 6: 125,322,173 I72T probably damaging Het
Sdk1 A T 5: 141,857,003 probably benign Het
Sfmbt2 T C 2: 10,445,745 L277P probably benign Het
Sgf29 A G 7: 126,664,982 E73G probably damaging Het
Slc12a6 T A 2: 112,352,961 F764L probably damaging Het
Slc4a2 T C 5: 24,435,342 probably null Het
Slc9a3 T G 13: 74,157,719 V285G probably damaging Het
Slc9c1 A G 16: 45,575,409 T608A probably benign Het
Slfnl1 C T 4: 120,535,685 R325C probably damaging Het
Smarcad1 T A 6: 65,074,914 F344I probably benign Het
Snrnp70 A T 7: 45,377,281 probably null Het
Sod2 C T 17: 13,008,186 T9M probably benign Het
Spag5 T A 11: 78,314,373 S633T probably damaging Het
Spta1 A T 1: 174,191,056 I531L probably benign Het
Stra8 A G 6: 34,933,156 E60G probably benign Het
Sult2a3 T A 7: 14,111,557 I126F probably benign Het
Syt1 T C 10: 108,504,512 H315R possibly damaging Het
Tanc2 T C 11: 105,867,762 L783P probably damaging Het
Thbs2 C T 17: 14,678,900 C646Y probably damaging Het
Ticam2 T A 18: 46,560,922 K33* probably null Het
Trim17 T C 11: 58,954,301 probably benign Het
Tsr1 G A 11: 74,907,879 M691I probably benign Het
Ttn T A 2: 76,762,419 I20790F probably damaging Het
Tubb2b A T 13: 34,128,185 Y208* probably null Het
Ubr1 T A 2: 120,914,938 I890F probably damaging Het
Usp54 T C 14: 20,562,192 E852G probably damaging Het
Vmn2r78 T C 7: 86,954,627 V671A probably damaging Het
Wipi1 T C 11: 109,579,649 K315E probably benign Het
Xrn2 T C 2: 147,051,718 V735A possibly damaging Het
Zdbf2 T A 1: 63,308,814 D2117E possibly damaging Het
Zfp287 A T 11: 62,714,136 C648* probably null Het
Zfp369 A G 13: 65,296,800 T586A possibly damaging Het
Other mutations in Col17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Col17a1 APN 19 47681403 missense probably damaging 1.00
IGL01620:Col17a1 APN 19 47668539 missense possibly damaging 0.81
IGL02149:Col17a1 APN 19 47668632 missense probably benign 0.01
IGL02176:Col17a1 APN 19 47651219 missense probably benign 0.02
IGL03352:Col17a1 APN 19 47681375 splice site probably null
IGL03409:Col17a1 APN 19 47666540 missense possibly damaging 0.79
fleabitten UTSW 19 47668105 nonsense probably null
scabby UTSW 19 47680408 nonsense probably null
testimony UTSW 19 47655190 critical splice donor site probably null
IGL03050:Col17a1 UTSW 19 47648098 critical splice donor site probably null
PIT4480001:Col17a1 UTSW 19 47671374 missense probably benign 0.05
R0309:Col17a1 UTSW 19 47671362 splice site probably benign
R0316:Col17a1 UTSW 19 47685533 critical splice donor site probably null
R0330:Col17a1 UTSW 19 47670432 missense probably benign 0.27
R0391:Col17a1 UTSW 19 47663824 missense probably damaging 0.99
R0570:Col17a1 UTSW 19 47665878 missense possibly damaging 0.93
R0737:Col17a1 UTSW 19 47669433 missense possibly damaging 0.95
R1344:Col17a1 UTSW 19 47671505 missense probably damaging 1.00
R1418:Col17a1 UTSW 19 47671505 missense probably damaging 1.00
R1549:Col17a1 UTSW 19 47648910 unclassified probably benign
R1585:Col17a1 UTSW 19 47650837 missense probably benign 0.00
R1710:Col17a1 UTSW 19 47670931 missense probably damaging 1.00
R1712:Col17a1 UTSW 19 47649003 unclassified probably benign
R1800:Col17a1 UTSW 19 47650862 missense possibly damaging 0.72
R2007:Col17a1 UTSW 19 47667702 missense probably damaging 1.00
R2024:Col17a1 UTSW 19 47650746 missense probably benign 0.02
R2258:Col17a1 UTSW 19 47681377 critical splice donor site probably null
R2268:Col17a1 UTSW 19 47650111 missense probably benign 0.00
R3608:Col17a1 UTSW 19 47680405 missense probably benign 0.00
R4380:Col17a1 UTSW 19 47657090 missense possibly damaging 0.94
R4675:Col17a1 UTSW 19 47663058 critical splice acceptor site probably null
R5058:Col17a1 UTSW 19 47685550 nonsense probably null
R5407:Col17a1 UTSW 19 47666507 missense probably damaging 1.00
R5417:Col17a1 UTSW 19 47662390 missense probably damaging 1.00
R5572:Col17a1 UTSW 19 47650729 missense probably benign 0.44
R5889:Col17a1 UTSW 19 47649072 missense possibly damaging 0.93
R5988:Col17a1 UTSW 19 47654220 missense probably damaging 1.00
R6054:Col17a1 UTSW 19 47680420 missense probably damaging 1.00
R6345:Col17a1 UTSW 19 47653379 missense possibly damaging 0.93
R6432:Col17a1 UTSW 19 47680408 nonsense probably null
R6484:Col17a1 UTSW 19 47670429 missense possibly damaging 0.67
R6754:Col17a1 UTSW 19 47650721 splice site probably null
R7028:Col17a1 UTSW 19 47652183 missense probably damaging 0.96
R7465:Col17a1 UTSW 19 47668105 nonsense probably null
R7565:Col17a1 UTSW 19 47671524 missense possibly damaging 0.77
R7662:Col17a1 UTSW 19 47681501 missense probably benign 0.04
R7726:Col17a1 UTSW 19 47655190 critical splice donor site probably null
R7957:Col17a1 UTSW 19 47661117 missense probably damaging 1.00
R8677:Col17a1 UTSW 19 47651801 missense probably benign 0.14
R8720:Col17a1 UTSW 19 47649092 critical splice acceptor site probably benign
R8877:Col17a1 UTSW 19 47648758 missense unknown
Z1088:Col17a1 UTSW 19 47652178 missense possibly damaging 0.85
Z1176:Col17a1 UTSW 19 47649429 small deletion probably benign
Z1177:Col17a1 UTSW 19 47650304 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CCTTTAGGAGGCCAGATCTG -3'
(R):5'- TTCAACATGGGGTCCACTGG -3'

Sequencing Primer
(F):5'- AGATCTGAACAGCTCACGTATG -3'
(R):5'- GTCTACCTCAGACCTACTGGG -3'
Posted On2016-04-15