Mutagenetix > Incidental Mutation

Incidental Mutation 'R4929:Lepr'

381076

Institutional Source

Beutler Lab

Gene Symbol

Lepr

Ensembl Gene

ENSMUSG00000057722

Gene Name

leptin receptor

Synonyms

obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT

MMRRC Submission

042530-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4929 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101717404-101815352 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101815117 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1113 (I1113V)

Ref Sequence

ENSEMBL: ENSMUSP00000037385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000106921]

AlphaFold

P48356

Predicted Effect

probably benign
Transcript: ENSMUST00000037552
AA Change: I1113V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: I1113V

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	328	418	6.3e-23	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC
low complexity region	908	921	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106921

SMART Domains

Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,574,042		noncoding transcript	Het
Abcd3	A	T	3: 121,768,746		probably null	Het
Adamts12	C	T	15: 11,259,022	R551C	probably damaging	Het
Adamtsl4	A	G	3: 95,678,005	C818R	probably damaging	Het
Arfgef3	T	A	10: 18,630,851	Q842L	probably benign	Het
Aurka	A	T	2: 172,370,406	V17E	probably benign	Het
Ccdc144b	G	A	3: 36,035,338	L146F	probably damaging	Het
Cdh24	C	T	14: 54,633,516	V132I	probably benign	Het
Cep57l1	T	C	10: 41,745,914	D2G	possibly damaging	Het
Cntn5	T	A	9: 9,976,395		probably null	Het
Col10a1	T	C	10: 34,395,124	I364T	probably benign	Het
Dpp6	G	A	5: 27,049,787	A67T	probably benign	Het
Dym	T	A	18: 75,243,286	V583E	probably damaging	Het
Efcab5	T	G	11: 77,103,383	K1259N	probably benign	Het
Ehbp1	T	G	11: 22,239,169	I78L	possibly damaging	Het
Epha1	C	A	6: 42,364,599	A469S	probably benign	Het
Fam135a	T	C	1: 24,030,000	D596G	probably benign	Het
Filip1	T	C	9: 79,819,747	N530S	probably benign	Het
Grhl2	A	G	15: 37,360,802	N610S	probably benign	Het
Haus6	T	C	4: 86,595,433	I331V	probably benign	Het
Ints2	G	T	11: 86,212,653	N1192K	possibly damaging	Het
Itga5	A	G	15: 103,353,235	V445A	probably benign	Het
Itga9	C	A	9: 118,807,249	D82E	probably damaging	Het
Jam2	G	A	16: 84,822,862		probably benign	Het
Klhl32	T	A	4: 24,709,030	I112F	probably damaging	Het
Lrrc3b	C	A	14: 15,357,888	L239F	probably damaging	Het
Lzic	T	A	4: 149,488,128		probably null	Het
Mxra8	T	A	4: 155,842,661	F351I	probably damaging	Het
Naa40	A	G	19: 7,229,982	F126L	probably damaging	Het
Nbeal1	C	T	1: 60,238,654	S733F	probably damaging	Het
Olfr183	A	C	16: 59,000,219	Y178S	probably damaging	Het
Olfr259	A	G	2: 87,108,183	F68S	possibly damaging	Het
Olfr686	A	G	7: 105,204,025	I106T	probably damaging	Het
Olr1	T	C	6: 129,500,081	T74A	probably damaging	Het
Pgam5	A	T	5: 110,265,825	V130D	probably damaging	Het
Pop4	A	G	7: 38,266,149	C115R	probably damaging	Het
Prpf18	A	T	2: 4,624,537		probably null	Het
Psg16	G	A	7: 17,095,106	R205H	possibly damaging	Het
Ptgr1	C	A	4: 58,981,879	A53S	probably benign	Het
Shank2	A	G	7: 144,411,271	D1451G	probably benign	Het
Slfn10-ps	A	G	11: 83,029,519		noncoding transcript	Het
Sox8	G	A	17: 25,570,356	A56V	probably benign	Het
Ssr3	A	G	3: 65,387,754	S113P	probably damaging	Het
Stx16	T	C	2: 174,096,928	Y296H	possibly damaging	Het
Tfcp2	A	T	15: 100,528,489	N60K	probably benign	Het
Thada	T	C	17: 84,444,226	T441A	probably benign	Het
Trf	G	T	9: 103,227,875		probably benign	Het
Vamp2	T	A	11: 69,088,662		probably benign	Het
Vmn2r105	A	T	17: 20,228,018	D181E	probably benign	Het
Vmn2r12	A	T	5: 109,091,678	Y340N	probably damaging	Het
Wasf2	C	A	4: 133,195,859	D493E	unknown	Het
Wdfy4	T	C	14: 33,047,256	D2084G	possibly damaging	Het
Zfp229	T	A	17: 21,746,373	I528N	probably damaging	Het
Zfp703	T	A	8: 26,978,851	V181E	possibly damaging	Het

Other mutations in Lepr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Lepr	APN	4	101815035	missense	probably benign
IGL01111:Lepr	APN	4	101814655	missense	possibly damaging	0.77
IGL01324:Lepr	APN	4	101768068	missense	probably benign	0.23
IGL01372:Lepr	APN	4	101735577	missense	possibly damaging	0.67
IGL01626:Lepr	APN	4	101733534	missense	probably benign	0.10
IGL01733:Lepr	APN	4	101765082	missense	probably benign	0.00
IGL01815:Lepr	APN	4	101814790	missense	possibly damaging	0.49
IGL01899:Lepr	APN	4	101779987	missense	possibly damaging	0.86
IGL02138:Lepr	APN	4	101768067	missense	probably damaging	0.98
IGL02161:Lepr	APN	4	101745678	missense	probably damaging	0.97
IGL02653:Lepr	APN	4	101764944	missense	probably benign	0.44
IGL02735:Lepr	APN	4	101782638	missense	probably damaging	1.00
IGL03035:Lepr	APN	4	101764980	missense	probably damaging	1.00
IGL03083:Lepr	APN	4	101814679	nonsense	probably null
IGL03160:Lepr	APN	4	101764906	missense	probably damaging	1.00
aufsetzigen	UTSW	4	101752175	missense	probably damaging	1.00
beastly	UTSW	4	101814591	missense	probably benign
business_class	UTSW	4	101764872	missense	probably damaging	1.00
cherub	UTSW	4	101768062	missense	probably benign	0.25
clodhopper	UTSW	4	101765290	splice site	probably null
donner	UTSW	4	101815201	missense	probably damaging	1.00
fluffy	UTSW	4	101792023	missense	probably damaging	1.00
giant	UTSW	4	101765152	critical splice donor site	probably null
gordo	UTSW	4	101765305	missense	probably damaging	0.97
Immunoglutton	UTSW	4	101765301	splice site	probably benign
Jumbo_shrimp	UTSW	4	101764954	nonsense	probably null
lowleaning	UTSW	4	101814391	splice site	probably null
odd	UTSW	4	101728074	splice site	probably benign
paleo	UTSW	4	101745645	missense	possibly damaging	0.94
R0140_Lepr_245	UTSW	4	101768067	missense	probably damaging	1.00
well-upholstered	UTSW	4	101772958	synonymous	probably benign
worldly	UTSW	4	101768228	missense	possibly damaging	0.96
PIT4651001:Lepr	UTSW	4	101791997	missense	probably damaging	1.00
PIT4696001:Lepr	UTSW	4	101779983	missense	probably benign	0.10
R0140:Lepr	UTSW	4	101768067	missense	probably damaging	1.00
R0197:Lepr	UTSW	4	101752152	missense	possibly damaging	0.64
R0279:Lepr	UTSW	4	101750344	missense	probably benign	0.05
R0487:Lepr	UTSW	4	101768093	nonsense	probably null
R0498:Lepr	UTSW	4	101745692	missense	probably benign	0.01
R0506:Lepr	UTSW	4	101773010	splice site	probably benign
R0512:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R0512:Lepr	UTSW	4	101814704	missense	possibly damaging	0.87
R0726:Lepr	UTSW	4	101764934	missense	probably benign	0.01
R1054:Lepr	UTSW	4	101782596	missense	probably damaging	0.97
R1109:Lepr	UTSW	4	101771355	missense	probably damaging	1.00
R1398:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1519:Lepr	UTSW	4	101789344	missense	probably damaging	0.97
R1602:Lepr	UTSW	4	101745645	missense	possibly damaging	0.94
R1830:Lepr	UTSW	4	101735677	missense	probably damaging	1.00
R1850:Lepr	UTSW	4	101733423	missense	possibly damaging	0.67
R1918:Lepr	UTSW	4	101772836	missense	probably benign	0.08
R1928:Lepr	UTSW	4	101782730	splice site	probably benign
R2099:Lepr	UTSW	4	101772988	missense	probably damaging	1.00
R2102:Lepr	UTSW	4	101772981	missense	possibly damaging	0.95
R2175:Lepr	UTSW	4	101765379	missense	probably benign	0.01
R2254:Lepr	UTSW	4	101815112	missense	probably benign	0.26
R2396:Lepr	UTSW	4	101733528	missense	probably benign	0.19
R2508:Lepr	UTSW	4	101790896	missense	probably damaging	0.98
R2571:Lepr	UTSW	4	101768172	missense	possibly damaging	0.96
R3790:Lepr	UTSW	4	101790914	splice site	probably benign
R3882:Lepr	UTSW	4	101815265	missense	probably damaging	1.00
R3933:Lepr	UTSW	4	101765301	splice site	probably benign
R4211:Lepr	UTSW	4	101733414	missense	probably benign	0.19
R4343:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4345:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4544:Lepr	UTSW	4	101768228	missense	possibly damaging	0.96
R4546:Lepr	UTSW	4	101814641	missense	probably benign	0.35
R4724:Lepr	UTSW	4	101765365	nonsense	probably null
R4797:Lepr	UTSW	4	101780047	missense	possibly damaging	0.90
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4939:Lepr	UTSW	4	101733438	missense	possibly damaging	0.78
R5377:Lepr	UTSW	4	101815019	missense	possibly damaging	0.71
R5520:Lepr	UTSW	4	101745537	missense	probably benign	0.00
R5966:Lepr	UTSW	4	101792127	intron	probably benign
R6092:Lepr	UTSW	4	101792023	missense	probably damaging	1.00
R6130:Lepr	UTSW	4	101765372	missense	probably damaging	0.99
R6168:Lepr	UTSW	4	101735592	missense	probably damaging	0.99
R6232:Lepr	UTSW	4	101814391	splice site	probably null
R6380:Lepr	UTSW	4	101764954	nonsense	probably null
R6427:Lepr	UTSW	4	101774257	missense	possibly damaging	0.47
R6428:Lepr	UTSW	4	101780098	missense	probably damaging	1.00
R6641:Lepr	UTSW	4	101765305	missense	probably damaging	0.97
R6650:Lepr	UTSW	4	101815201	missense	probably damaging	1.00
R6859:Lepr	UTSW	4	101765290	splice site	probably null
R7023:Lepr	UTSW	4	101789287	missense	probably damaging	1.00
R7145:Lepr	UTSW	4	101752197	missense	probably benign	0.00
R7174:Lepr	UTSW	4	101750338	missense	probably benign	0.01
R7179:Lepr	UTSW	4	101745659	missense	probably benign	0.06
R7189:Lepr	UTSW	4	101814764	missense	probably benign	0.00
R7426:Lepr	UTSW	4	101745656	missense	probably benign	0.03
R7531:Lepr	UTSW	4	101752175	missense	probably damaging	1.00
R7620:Lepr	UTSW	4	101752073	missense	probably benign	0.41
R7804:Lepr	UTSW	4	101782586	missense	probably damaging	1.00
R8022:Lepr	UTSW	4	101782557	missense	probably benign	0.32
R8142:Lepr	UTSW	4	101765419	missense	possibly damaging	0.93
R8227:Lepr	UTSW	4	101771362	missense	probably damaging	0.99
R8426:Lepr	UTSW	4	101814644	missense	probably benign	0.12
R8447:Lepr	UTSW	4	101814491	missense	probably benign	0.08
R8531:Lepr	UTSW	4	101765415	missense	probably damaging	1.00
R8682:Lepr	UTSW	4	101792072	missense	probably benign	0.00
R8897:Lepr	UTSW	4	101792036	missense	probably damaging	0.98
R9096:Lepr	UTSW	4	101774221	missense	possibly damaging	0.95
R9177:Lepr	UTSW	4	101745601	nonsense	probably null
R9241:Lepr	UTSW	4	101814591	missense	probably benign
R9604:Lepr	UTSW	4	101733276	missense	probably benign	0.01
R9711:Lepr	UTSW	4	101735654	nonsense	probably null
X0026:Lepr	UTSW	4	101733327	missense	possibly damaging	0.47
Z1176:Lepr	UTSW	4	101745614	missense	probably damaging	0.99
Z1177:Lepr	UTSW	4	101735595	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCTCTAGCAGCTCCTGGG -3'
(R):5'- CTGGAATGGAACCTTGAGGC -3'

Sequencing Primer
(F):5'- GAGACAGAGGCCCAGACATTTTTC -3'
(R):5'- AGGCTTCTTGGATGAGATTACACAG -3'

Posted On

2016-04-15