Mutagenetix > Incidental Mutation

Incidental Mutation 'R4929:4930432E11Rik'

381087

Institutional Source

Beutler Lab

Gene Symbol

4930432E11Rik

Ensembl Gene

ENSMUSG00000046958

Gene Name

RIKEN cDNA 4930432E11 gene

Synonyms

MMRRC Submission

042530-MU

Accession Numbers

NCBI RefSeq: none; Ensembl: ENSMUST00000053635; MGI:3045259

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R4929 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29558579-29582169 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 29574042 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000053635

SMART Domains

Protein: ENSMUSP00000049518
Gene: ENSMUSG00000046958

Domain	Start	End	E-Value	Type
Blast:WD40	43	79	3e-11	BLAST
WD40	131	172	1.97e2	SMART
WD40	175	214	2.24e-2	SMART
Blast:WD40	257	296	4e-15	BLAST
WD40	393	437	1.32e2	SMART
WD40	494	533	2.15e-4	SMART
low complexity region	598	617	N/A	INTRINSIC
low complexity region	1082	1094	N/A	INTRINSIC
low complexity region	1107	1148	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000063585

SMART Domains

Protein: ENSMUSP00000063695
Gene: ENSMUSG00000051976

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
internal_repeat_1	35	67	3.29e-5	PROSPERO
internal_repeat_1	73	102	3.29e-5	PROSPERO
low complexity region	122	135	N/A	INTRINSIC
coiled coil region	161	182	N/A	INTRINSIC
low complexity region	216	233	N/A	INTRINSIC
low complexity region	239	249	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187265

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.9%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd3	A	T	3: 121,768,746		probably null	Het
Adamts12	C	T	15: 11,259,022	R551C	probably damaging	Het
Adamtsl4	A	G	3: 95,678,005	C818R	probably damaging	Het
Arfgef3	T	A	10: 18,630,851	Q842L	probably benign	Het
Aurka	A	T	2: 172,370,406	V17E	probably benign	Het
Ccdc144b	G	A	3: 36,035,338	L146F	probably damaging	Het
Cdh24	C	T	14: 54,633,516	V132I	probably benign	Het
Cep57l1	T	C	10: 41,745,914	D2G	possibly damaging	Het
Cntn5	T	A	9: 9,976,395		probably null	Het
Col10a1	T	C	10: 34,395,124	I364T	probably benign	Het
Dpp6	G	A	5: 27,049,787	A67T	probably benign	Het
Dym	T	A	18: 75,243,286	V583E	probably damaging	Het
Efcab5	T	G	11: 77,103,383	K1259N	probably benign	Het
Ehbp1	T	G	11: 22,239,169	I78L	possibly damaging	Het
Epha1	C	A	6: 42,364,599	A469S	probably benign	Het
Fam135a	T	C	1: 24,030,000	D596G	probably benign	Het
Filip1	T	C	9: 79,819,747	N530S	probably benign	Het
Grhl2	A	G	15: 37,360,802	N610S	probably benign	Het
Haus6	T	C	4: 86,595,433	I331V	probably benign	Het
Ints2	G	T	11: 86,212,653	N1192K	possibly damaging	Het
Itga5	A	G	15: 103,353,235	V445A	probably benign	Het
Itga9	C	A	9: 118,807,249	D82E	probably damaging	Het
Jam2	G	A	16: 84,822,862		probably benign	Het
Klhl32	T	A	4: 24,709,030	I112F	probably damaging	Het
Lepr	A	G	4: 101,815,117	I1113V	probably benign	Het
Lrrc3b	C	A	14: 15,357,888	L239F	probably damaging	Het
Lzic	T	A	4: 149,488,128		probably null	Het
Mxra8	T	A	4: 155,842,661	F351I	probably damaging	Het
Naa40	A	G	19: 7,229,982	F126L	probably damaging	Het
Nbeal1	C	T	1: 60,238,654	S733F	probably damaging	Het
Olfr183	A	C	16: 59,000,219	Y178S	probably damaging	Het
Olfr259	A	G	2: 87,108,183	F68S	possibly damaging	Het
Olfr686	A	G	7: 105,204,025	I106T	probably damaging	Het
Olr1	T	C	6: 129,500,081	T74A	probably damaging	Het
Pgam5	A	T	5: 110,265,825	V130D	probably damaging	Het
Pop4	A	G	7: 38,266,149	C115R	probably damaging	Het
Prpf18	A	T	2: 4,624,537		probably null	Het
Psg16	G	A	7: 17,095,106	R205H	possibly damaging	Het
Ptgr1	C	A	4: 58,981,879	A53S	probably benign	Het
Shank2	A	G	7: 144,411,271	D1451G	probably benign	Het
Slfn10-ps	A	G	11: 83,029,519		noncoding transcript	Het
Sox8	G	A	17: 25,570,356	A56V	probably benign	Het
Ssr3	A	G	3: 65,387,754	S113P	probably damaging	Het
Stx16	T	C	2: 174,096,928	Y296H	possibly damaging	Het
Tfcp2	A	T	15: 100,528,489	N60K	probably benign	Het
Thada	T	C	17: 84,444,226	T441A	probably benign	Het
Trf	G	T	9: 103,227,875		probably benign	Het
Vamp2	T	A	11: 69,088,662		probably benign	Het
Vmn2r105	A	T	17: 20,228,018	D181E	probably benign	Het
Vmn2r12	A	T	5: 109,091,678	Y340N	probably damaging	Het
Wasf2	C	A	4: 133,195,859	D493E	unknown	Het
Wdfy4	T	C	14: 33,047,256	D2084G	possibly damaging	Het
Zfp229	T	A	17: 21,746,373	I528N	probably damaging	Het
Zfp703	T	A	8: 26,978,851	V181E	possibly damaging	Het

Other mutations in 4930432E11Rik

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL01121:4930432E11Rik	APN	7	29574001	unclassified	noncoding transcript
IGL01955:4930432E11Rik	APN	7	29573995	unclassified	noncoding transcript
IGL01971:4930432E11Rik	APN	7	29574562	unclassified	noncoding transcript
IGL02132:4930432E11Rik	APN	7	29563279	unclassified	noncoding transcript
IGL02484:4930432E11Rik	APN	7	29563352	unclassified	noncoding transcript
P0016:4930432E11Rik	UTSW	7	29563112	unclassified	noncoding transcript
R0051:4930432E11Rik	UTSW	7	29579101	exon	noncoding transcript
R0060:4930432E11Rik	UTSW	7	29574170	unclassified	noncoding transcript
R0094:4930432E11Rik	UTSW	7	29560811	exon	noncoding transcript
R0268:4930432E11Rik	UTSW	7	29574602	unclassified	noncoding transcript
R0423:4930432E11Rik	UTSW	7	29562400	exon	noncoding transcript
R0478:4930432E11Rik	UTSW	7	29562589	exon	noncoding transcript
R0646:4930432E11Rik	UTSW	7	29561285	exon	noncoding transcript
R1208:4930432E11Rik	UTSW	7	29561283	exon	noncoding transcript
R1778:4930432E11Rik	UTSW	7	29560706	exon	noncoding transcript
R1779:4930432E11Rik	UTSW	7	29579166	exon	noncoding transcript
R1918:4930432E11Rik	UTSW	7	29574089	unclassified	noncoding transcript
R2360:4930432E11Rik	UTSW	7	29574789	unclassified	noncoding transcript
R3736:4930432E11Rik	UTSW	7	29574571	unclassified	noncoding transcript
R3780:4930432E11Rik	UTSW	7	29560838	exon	noncoding transcript
R4427:4930432E11Rik	UTSW	7	29579253	exon	noncoding transcript
R4835:4930432E11Rik	UTSW	7	29574901	unclassified	noncoding transcript
R5042:4930432E11Rik	UTSW	7	29574502	unclassified	noncoding transcript
R5129:4930432E11Rik	UTSW	7	29561361	exon	noncoding transcript
R5371:4930432E11Rik	UTSW	7	29562493	exon	noncoding transcript
R5381:4930432E11Rik	UTSW	7	29562968	unclassified	noncoding transcript
R5586:4930432E11Rik	UTSW	7	29577728	unclassified	noncoding transcript
R5874:4930432E11Rik	UTSW	7	29581185	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TGTCTTACCCACTGCTCAGAATTG -3'
(R):5'- GACTGCTTTCTGTGAGCCAG -3'

Sequencing Primer
(F):5'- ACCCACTGCTCAGAATTGTCTTC -3'
(R):5'- GCCTTATTAGCCCCAGATAGG -3'

Posted On

2016-04-15