Incidental Mutation 'R4929:Col10a1'
ID381096
Institutional Source Beutler Lab
Gene Symbol Col10a1
Ensembl Gene ENSMUSG00000039462
Gene Namecollagen, type X, alpha 1
SynonymsCol10a-1, Col10
MMRRC Submission 042530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4929 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location34389981-34397085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34395124 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 364 (I364T)
Ref Sequence ENSEMBL: ENSMUSP00000101150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047885] [ENSMUST00000099973] [ENSMUST00000105511] [ENSMUST00000105512] [ENSMUST00000213269]
Predicted Effect probably benign
Transcript: ENSMUST00000047885
SMART Domains Protein: ENSMUSP00000047126
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 382 2.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099973
SMART Domains Protein: ENSMUSP00000097553
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 189 8.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105511
AA Change: I364T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101150
Gene: ENSMUSG00000039462
AA Change: I364T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 60 101 N/A INTRINSIC
Pfam:Collagen 103 155 1.4e-9 PFAM
Pfam:Collagen 153 218 1.4e-8 PFAM
Pfam:Collagen 193 250 2.6e-9 PFAM
Pfam:Collagen 206 264 3.8e-8 PFAM
low complexity region 282 323 N/A INTRINSIC
internal_repeat_2 329 361 2.25e-6 PROSPERO
internal_repeat_1 331 365 5.9e-14 PROSPERO
low complexity region 368 383 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
Pfam:Collagen 413 483 9.3e-10 PFAM
low complexity region 487 517 N/A INTRINSIC
C1Q 545 680 2.85e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105512
SMART Domains Protein: ENSMUSP00000101151
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 372 8.7e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130290
Predicted Effect probably benign
Transcript: ENSMUST00000213269
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type X collagen, a short chain collagen expressed by hypertrophic chondrocytes during endochondral ossification. Unlike type VIII collagen, the other short chain collagen, type X collagen is a homotrimer. Mutations in this gene are associated with Schmid type metaphyseal chondrodysplasia (SMCD) and Japanese type spondylometaphyseal dysplasia (SMD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations may exhibit abnormal trabecular bone, thinner growth plate resting zone and articular cartilage, and altered bone content. Mice homozygous for another knock-out allele exhibit altered B and T cell populations and TH1/TH2responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,574,042 noncoding transcript Het
Abcd3 A T 3: 121,768,746 probably null Het
Adamts12 C T 15: 11,259,022 R551C probably damaging Het
Adamtsl4 A G 3: 95,678,005 C818R probably damaging Het
Arfgef3 T A 10: 18,630,851 Q842L probably benign Het
Aurka A T 2: 172,370,406 V17E probably benign Het
Ccdc144b G A 3: 36,035,338 L146F probably damaging Het
Cdh24 C T 14: 54,633,516 V132I probably benign Het
Cep57l1 T C 10: 41,745,914 D2G possibly damaging Het
Cntn5 T A 9: 9,976,395 probably null Het
Dpp6 G A 5: 27,049,787 A67T probably benign Het
Dym T A 18: 75,243,286 V583E probably damaging Het
Efcab5 T G 11: 77,103,383 K1259N probably benign Het
Ehbp1 T G 11: 22,239,169 I78L possibly damaging Het
Epha1 C A 6: 42,364,599 A469S probably benign Het
Fam135a T C 1: 24,030,000 D596G probably benign Het
Filip1 T C 9: 79,819,747 N530S probably benign Het
Grhl2 A G 15: 37,360,802 N610S probably benign Het
Haus6 T C 4: 86,595,433 I331V probably benign Het
Ints2 G T 11: 86,212,653 N1192K possibly damaging Het
Itga5 A G 15: 103,353,235 V445A probably benign Het
Itga9 C A 9: 118,807,249 D82E probably damaging Het
Jam2 G A 16: 84,822,862 probably benign Het
Klhl32 T A 4: 24,709,030 I112F probably damaging Het
Lepr A G 4: 101,815,117 I1113V probably benign Het
Lrrc3b C A 14: 15,357,888 L239F probably damaging Het
Lzic T A 4: 149,488,128 probably null Het
Mxra8 T A 4: 155,842,661 F351I probably damaging Het
Naa40 A G 19: 7,229,982 F126L probably damaging Het
Nbeal1 C T 1: 60,238,654 S733F probably damaging Het
Olfr183 A C 16: 59,000,219 Y178S probably damaging Het
Olfr259 A G 2: 87,108,183 F68S possibly damaging Het
Olfr686 A G 7: 105,204,025 I106T probably damaging Het
Olr1 T C 6: 129,500,081 T74A probably damaging Het
Pgam5 A T 5: 110,265,825 V130D probably damaging Het
Pop4 A G 7: 38,266,149 C115R probably damaging Het
Prpf18 A T 2: 4,624,537 probably null Het
Psg16 G A 7: 17,095,106 R205H possibly damaging Het
Ptgr1 C A 4: 58,981,879 A53S probably benign Het
Shank2 A G 7: 144,411,271 D1451G probably benign Het
Slfn10-ps A G 11: 83,029,519 noncoding transcript Het
Sox8 G A 17: 25,570,356 A56V probably benign Het
Ssr3 A G 3: 65,387,754 S113P probably damaging Het
Stx16 T C 2: 174,096,928 Y296H possibly damaging Het
Tfcp2 A T 15: 100,528,489 N60K probably benign Het
Thada T C 17: 84,444,226 T441A probably benign Het
Trf G T 9: 103,227,875 probably benign Het
Vamp2 T A 11: 69,088,662 probably benign Het
Vmn2r105 A T 17: 20,228,018 D181E probably benign Het
Vmn2r12 A T 5: 109,091,678 Y340N probably damaging Het
Wasf2 C A 4: 133,195,859 D493E unknown Het
Wdfy4 T C 14: 33,047,256 D2084G possibly damaging Het
Zfp229 T A 17: 21,746,373 I528N probably damaging Het
Zfp703 T A 8: 26,978,851 V181E possibly damaging Het
Other mutations in Col10a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03005:Col10a1 APN 10 34395738 missense probably damaging 1.00
IGL03028:Col10a1 APN 10 34395016 missense probably benign 0.19
R0580:Col10a1 UTSW 10 34394952 missense probably benign 0.31
R0691:Col10a1 UTSW 10 34395696 missense possibly damaging 0.94
R1187:Col10a1 UTSW 10 34394838 missense probably benign 0.13
R1597:Col10a1 UTSW 10 34395078 missense probably damaging 0.99
R1724:Col10a1 UTSW 10 34395718 missense probably damaging 1.00
R1826:Col10a1 UTSW 10 34394649 missense probably damaging 1.00
R1834:Col10a1 UTSW 10 34395015 missense probably damaging 1.00
R2156:Col10a1 UTSW 10 34395700 missense probably benign 0.30
R3687:Col10a1 UTSW 10 34395498 missense probably benign 0.12
R4208:Col10a1 UTSW 10 34395543 missense probably damaging 0.99
R5411:Col10a1 UTSW 10 34394557 missense probably damaging 1.00
R5433:Col10a1 UTSW 10 34390739 intron probably benign
R5481:Col10a1 UTSW 10 34395664 missense probably benign 0.09
R6036:Col10a1 UTSW 10 34395282 missense probably benign
R6036:Col10a1 UTSW 10 34395282 missense probably benign
R6208:Col10a1 UTSW 10 34394586 missense possibly damaging 0.69
R6223:Col10a1 UTSW 10 34395187 missense probably damaging 1.00
R7019:Col10a1 UTSW 10 34394951 missense probably damaging 0.96
R7642:Col10a1 UTSW 10 34395642 missense probably benign 0.00
R7784:Col10a1 UTSW 10 34394218 missense unknown
R8072:Col10a1 UTSW 10 34390667 missense unknown
R8711:Col10a1 UTSW 10 34394828 missense probably damaging 1.00
Z1176:Col10a1 UTSW 10 34395178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAAAACAAGGCTTGCCAG -3'
(R):5'- ACTCCTTTAGCTCCTACAGGG -3'

Sequencing Primer
(F):5'- AACAAGGCTTGCCAGGTTTG -3'
(R):5'- TTTAGCTCCTACAGGGCCAACAG -3'
Posted On2016-04-15