Mutagenetix > Incidental Mutations

Incidental Mutation 'R4929:Ints2'

381102

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

042530-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4929 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 86212653 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1192 (N1192K)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018212
AA Change: N1192K

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: N1192K

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108039
AA Change: N1192K

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: N1192K

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128960

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,574,042		noncoding transcript	Het
Abcd3	A	T	3: 121,768,746		probably null	Het
Adamts12	C	T	15: 11,259,022	R551C	probably damaging	Het
Adamtsl4	A	G	3: 95,678,005	C818R	probably damaging	Het
Arfgef3	T	A	10: 18,630,851	Q842L	probably benign	Het
Aurka	A	T	2: 172,370,406	V17E	probably benign	Het
Ccdc144b	G	A	3: 36,035,338	L146F	probably damaging	Het
Cdh24	C	T	14: 54,633,516	V132I	probably benign	Het
Cep57l1	T	C	10: 41,745,914	D2G	possibly damaging	Het
Cntn5	T	A	9: 9,976,395		probably null	Het
Col10a1	T	C	10: 34,395,124	I364T	probably benign	Het
Dpp6	G	A	5: 27,049,787	A67T	probably benign	Het
Dym	T	A	18: 75,243,286	V583E	probably damaging	Het
Efcab5	T	G	11: 77,103,383	K1259N	probably benign	Het
Ehbp1	T	G	11: 22,239,169	I78L	possibly damaging	Het
Epha1	C	A	6: 42,364,599	A469S	probably benign	Het
Fam135a	T	C	1: 24,030,000	D596G	probably benign	Het
Filip1	T	C	9: 79,819,747	N530S	probably benign	Het
Grhl2	A	G	15: 37,360,802	N610S	probably benign	Het
Haus6	T	C	4: 86,595,433	I331V	probably benign	Het
Itga5	A	G	15: 103,353,235	V445A	probably benign	Het
Itga9	C	A	9: 118,807,249	D82E	probably damaging	Het
Jam2	G	A	16: 84,822,862		probably benign	Het
Klhl32	T	A	4: 24,709,030	I112F	probably damaging	Het
Lepr	A	G	4: 101,815,117	I1113V	probably benign	Het
Lrrc3b	C	A	14: 15,357,888	L239F	probably damaging	Het
Lzic	T	A	4: 149,488,128		probably null	Het
Mxra8	T	A	4: 155,842,661	F351I	probably damaging	Het
Naa40	A	G	19: 7,229,982	F126L	probably damaging	Het
Nbeal1	C	T	1: 60,238,654	S733F	probably damaging	Het
Olfr183	A	C	16: 59,000,219	Y178S	probably damaging	Het
Olfr259	A	G	2: 87,108,183	F68S	possibly damaging	Het
Olfr686	A	G	7: 105,204,025	I106T	probably damaging	Het
Olr1	T	C	6: 129,500,081	T74A	probably damaging	Het
Pgam5	A	T	5: 110,265,825	V130D	probably damaging	Het
Pop4	A	G	7: 38,266,149	C115R	probably damaging	Het
Prpf18	A	T	2: 4,624,537		probably null	Het
Psg16	G	A	7: 17,095,106	R205H	possibly damaging	Het
Ptgr1	C	A	4: 58,981,879	A53S	probably benign	Het
Shank2	A	G	7: 144,411,271	D1451G	probably benign	Het
Slfn10-ps	A	G	11: 83,029,519		noncoding transcript	Het
Sox8	G	A	17: 25,570,356	A56V	probably benign	Het
Ssr3	A	G	3: 65,387,754	S113P	probably damaging	Het
Stx16	T	C	2: 174,096,928	Y296H	possibly damaging	Het
Tfcp2	A	T	15: 100,528,489	N60K	probably benign	Het
Thada	T	C	17: 84,444,226	T441A	probably benign	Het
Trf	G	T	9: 103,227,875		probably benign	Het
Vamp2	T	A	11: 69,088,662		probably benign	Het
Vmn2r105	A	T	17: 20,228,018	D181E	probably benign	Het
Vmn2r12	A	T	5: 109,091,678	Y340N	probably damaging	Het
Wasf2	C	A	4: 133,195,859	D493E	unknown	Het
Wdfy4	T	C	14: 33,047,256	D2084G	possibly damaging	Het
Zfp229	T	A	17: 21,746,373	I528N	probably damaging	Het
Zfp703	T	A	8: 26,978,851	V181E	possibly damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCATCAGAGCAGATCCAAAGATATG -3'
(R):5'- CTCTGATGTTGCCACTCAGAC -3'

Sequencing Primer
(F):5'- GCCAATCAAACAAGTATAATTCTCAG -3'
(R):5'- TCTGATGTTGCCACTCAGACAAGAG -3'

Posted On

2016-04-15