Mutagenetix > Incidental Mutation

Incidental Mutation 'R4929:Vmn2r105'

381112

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r105

Ensembl Gene

ENSMUSG00000091670

Gene Name

vomeronasal 2, receptor 105

Synonyms

EG627743

MMRRC Submission

042530-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4929 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20208230-20234872 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20228018 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 181 (D181E)

Ref Sequence

ENSEMBL: ENSMUSP00000129762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167382]

AlphaFold

E9Q3A5

Predicted Effect

probably benign
Transcript: ENSMUST00000167382
AA Change: D181E

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000129762
Gene: ENSMUSG00000091670
AA Change: D181E

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	85	469	6.5e-42	PFAM
Pfam:NCD3G	512	565	3.2e-21	PFAM
Pfam:7tm_3	598	833	2.5e-51	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.9%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,574,042		noncoding transcript	Het
Abcd3	A	T	3: 121,768,746		probably null	Het
Adamts12	C	T	15: 11,259,022	R551C	probably damaging	Het
Adamtsl4	A	G	3: 95,678,005	C818R	probably damaging	Het
Arfgef3	T	A	10: 18,630,851	Q842L	probably benign	Het
Aurka	A	T	2: 172,370,406	V17E	probably benign	Het
Ccdc144b	G	A	3: 36,035,338	L146F	probably damaging	Het
Cdh24	C	T	14: 54,633,516	V132I	probably benign	Het
Cep57l1	T	C	10: 41,745,914	D2G	possibly damaging	Het
Cntn5	T	A	9: 9,976,395		probably null	Het
Col10a1	T	C	10: 34,395,124	I364T	probably benign	Het
Dpp6	G	A	5: 27,049,787	A67T	probably benign	Het
Dym	T	A	18: 75,243,286	V583E	probably damaging	Het
Efcab5	T	G	11: 77,103,383	K1259N	probably benign	Het
Ehbp1	T	G	11: 22,239,169	I78L	possibly damaging	Het
Epha1	C	A	6: 42,364,599	A469S	probably benign	Het
Fam135a	T	C	1: 24,030,000	D596G	probably benign	Het
Filip1	T	C	9: 79,819,747	N530S	probably benign	Het
Grhl2	A	G	15: 37,360,802	N610S	probably benign	Het
Haus6	T	C	4: 86,595,433	I331V	probably benign	Het
Ints2	G	T	11: 86,212,653	N1192K	possibly damaging	Het
Itga5	A	G	15: 103,353,235	V445A	probably benign	Het
Itga9	C	A	9: 118,807,249	D82E	probably damaging	Het
Jam2	G	A	16: 84,822,862		probably benign	Het
Klhl32	T	A	4: 24,709,030	I112F	probably damaging	Het
Lepr	A	G	4: 101,815,117	I1113V	probably benign	Het
Lrrc3b	C	A	14: 15,357,888	L239F	probably damaging	Het
Lzic	T	A	4: 149,488,128		probably null	Het
Mxra8	T	A	4: 155,842,661	F351I	probably damaging	Het
Naa40	A	G	19: 7,229,982	F126L	probably damaging	Het
Nbeal1	C	T	1: 60,238,654	S733F	probably damaging	Het
Olfr183	A	C	16: 59,000,219	Y178S	probably damaging	Het
Olfr259	A	G	2: 87,108,183	F68S	possibly damaging	Het
Olfr686	A	G	7: 105,204,025	I106T	probably damaging	Het
Olr1	T	C	6: 129,500,081	T74A	probably damaging	Het
Pgam5	A	T	5: 110,265,825	V130D	probably damaging	Het
Pop4	A	G	7: 38,266,149	C115R	probably damaging	Het
Prpf18	A	T	2: 4,624,537		probably null	Het
Psg16	G	A	7: 17,095,106	R205H	possibly damaging	Het
Ptgr1	C	A	4: 58,981,879	A53S	probably benign	Het
Shank2	A	G	7: 144,411,271	D1451G	probably benign	Het
Slfn10-ps	A	G	11: 83,029,519		noncoding transcript	Het
Sox8	G	A	17: 25,570,356	A56V	probably benign	Het
Ssr3	A	G	3: 65,387,754	S113P	probably damaging	Het
Stx16	T	C	2: 174,096,928	Y296H	possibly damaging	Het
Tfcp2	A	T	15: 100,528,489	N60K	probably benign	Het
Thada	T	C	17: 84,444,226	T441A	probably benign	Het
Trf	G	T	9: 103,227,875		probably benign	Het
Vamp2	T	A	11: 69,088,662		probably benign	Het
Vmn2r12	A	T	5: 109,091,678	Y340N	probably damaging	Het
Wasf2	C	A	4: 133,195,859	D493E	unknown	Het
Wdfy4	T	C	14: 33,047,256	D2084G	possibly damaging	Het
Zfp229	T	A	17: 21,746,373	I528N	probably damaging	Het
Zfp703	T	A	8: 26,978,851	V181E	possibly damaging	Het

Other mutations in Vmn2r105

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01433:Vmn2r105	APN	17	20228555	missense	probably benign	0.01
IGL01909:Vmn2r105	APN	17	20224656	missense	probably damaging	1.00
IGL01925:Vmn2r105	APN	17	20208711	missense	possibly damaging	0.94
IGL02021:Vmn2r105	APN	17	20227895	missense	possibly damaging	0.49
IGL02828:Vmn2r105	APN	17	20209083	missense	possibly damaging	0.80
IGL02838:Vmn2r105	APN	17	20227585	missense	probably damaging	1.00
IGL03343:Vmn2r105	APN	17	20226369	nonsense	probably null
R0096:Vmn2r105	UTSW	17	20227479	missense	possibly damaging	0.49
R0096:Vmn2r105	UTSW	17	20227479	missense	possibly damaging	0.49
R0212:Vmn2r105	UTSW	17	20208565	missense	possibly damaging	0.90
R0268:Vmn2r105	UTSW	17	20208676	missense	probably benign	0.18
R0271:Vmn2r105	UTSW	17	20234703	missense	probably damaging	0.96
R0613:Vmn2r105	UTSW	17	20208316	missense	probably damaging	1.00
R0765:Vmn2r105	UTSW	17	20227711	missense	probably benign	0.20
R0765:Vmn2r105	UTSW	17	20227857	missense	probably damaging	0.98
R1162:Vmn2r105	UTSW	17	20227711	missense	probably benign	0.20
R1263:Vmn2r105	UTSW	17	20208322	missense	probably damaging	1.00
R1363:Vmn2r105	UTSW	17	20208670	missense	probably benign	0.00
R1464:Vmn2r105	UTSW	17	20228742	splice site	probably benign
R2029:Vmn2r105	UTSW	17	20224578	missense	probably damaging	0.99
R2420:Vmn2r105	UTSW	17	20227835	missense	probably benign	0.15
R2421:Vmn2r105	UTSW	17	20227835	missense	probably benign	0.15
R2422:Vmn2r105	UTSW	17	20227835	missense	probably benign	0.15
R2570:Vmn2r105	UTSW	17	20227323	missense	probably damaging	1.00
R3847:Vmn2r105	UTSW	17	20208690	missense	possibly damaging	0.85
R3848:Vmn2r105	UTSW	17	20208690	missense	possibly damaging	0.85
R4030:Vmn2r105	UTSW	17	20208754	missense	probably damaging	0.99
R4275:Vmn2r105	UTSW	17	20228640	missense	probably damaging	1.00
R4551:Vmn2r105	UTSW	17	20226351	missense	probably benign
R4801:Vmn2r105	UTSW	17	20227294	missense	probably benign	0.00
R4802:Vmn2r105	UTSW	17	20227294	missense	probably benign	0.00
R4816:Vmn2r105	UTSW	17	20208691	missense	probably benign	0.27
R5022:Vmn2r105	UTSW	17	20208414	missense	probably damaging	0.99
R5475:Vmn2r105	UTSW	17	20234782	missense	probably benign
R5576:Vmn2r105	UTSW	17	20224574	critical splice donor site	probably null
R5795:Vmn2r105	UTSW	17	20228736	missense	probably benign	0.00
R5895:Vmn2r105	UTSW	17	20228667	missense	probably benign	0.10
R6017:Vmn2r105	UTSW	17	20208627	missense	probably damaging	0.97
R6210:Vmn2r105	UTSW	17	20228496	missense	probably damaging	1.00
R6491:Vmn2r105	UTSW	17	20227730	nonsense	probably null
R6542:Vmn2r105	UTSW	17	20228541	missense	probably benign	0.03
R6729:Vmn2r105	UTSW	17	20208343	missense	probably damaging	0.99
R7020:Vmn2r105	UTSW	17	20209074	missense	probably damaging	1.00
R7033:Vmn2r105	UTSW	17	20208612	missense	probably damaging	0.97
R7488:Vmn2r105	UTSW	17	20208783	missense	probably damaging	1.00
R7491:Vmn2r105	UTSW	17	20228565	missense	probably benign	0.02
R7555:Vmn2r105	UTSW	17	20227675	missense	probably damaging	0.98
R7863:Vmn2r105	UTSW	17	20208675	missense	probably benign	0.18
R8137:Vmn2r105	UTSW	17	20234704	missense	probably benign	0.02
R8166:Vmn2r105	UTSW	17	20208642	missense	probably benign	0.07
R8186:Vmn2r105	UTSW	17	20224618	nonsense	probably null
R8214:Vmn2r105	UTSW	17	20228513	missense	probably benign	0.02
R8497:Vmn2r105	UTSW	17	20234872	start codon destroyed	probably null	0.75
R8850:Vmn2r105	UTSW	17	20208610	missense	probably damaging	1.00
R8880:Vmn2r105	UTSW	17	20208967	missense	probably damaging	0.99
R9272:Vmn2r105	UTSW	17	20227423	missense	probably damaging	1.00
R9506:Vmn2r105	UTSW	17	20209142	missense	probably benign	0.00
R9549:Vmn2r105	UTSW	17	20227761	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- CAGGTGGCAGGGATCATTTTC -3'
(R):5'- CAGGCTTGCCAGGAATTTCTG -3'

Sequencing Primer
(F):5'- TGGCAGGGATCATTTTCACAAAAGC -3'
(R):5'- GGCTTGCCAGGAATTTCTGTAAAATG -3'

Posted On

2016-04-15