Incidental Mutation 'R4930:Ehf'
ID 381128
Institutional Source Beutler Lab
Gene Symbol Ehf
Ensembl Gene ENSMUSG00000012350
Gene Name ets homologous factor
Synonyms 9030625L19Rik
MMRRC Submission 042531-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.711) question?
Stock # R4930 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 103093776-103133620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 103097202 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 250 (R250L)
Ref Sequence ENSEMBL: ENSMUSP00000106807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090475] [ENSMUST00000111174] [ENSMUST00000111176] [ENSMUST00000125788]
AlphaFold O70273
Predicted Effect probably damaging
Transcript: ENSMUST00000090475
AA Change: R273L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087961
Gene: ENSMUSG00000012350
AA Change: R273L

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111174
AA Change: R273L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106805
Gene: ENSMUSG00000012350
AA Change: R273L

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111176
AA Change: R250L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106807
Gene: ENSMUSG00000012350
AA Change: R250L

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 183 270 1.84e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125788
SMART Domains Protein: ENSMUSP00000121103
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 42 126 1.39e-35 SMART
PDB:3JTG|A 215 242 1e-8 PDB
Blast:ETS 217 242 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137774
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to an ETS transcription factor subfamily characterized by epithelial-specific expression (ESEs). The encoded protein acts as a transcriptional repressor and may be involved in epithelial differentiation and carcinogenesis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C T 12: 72,953,008 (GRCm39) E242K possibly damaging Het
A930011G23Rik A G 5: 99,370,263 (GRCm39) M499T possibly damaging Het
Abcb8 G A 5: 24,605,779 (GRCm39) V196M possibly damaging Het
Ahnak T C 19: 8,988,331 (GRCm39) M3205T possibly damaging Het
Ankrd1 A G 19: 36,092,433 (GRCm39) Y265H probably damaging Het
Apeh A G 9: 107,965,024 (GRCm39) S446P probably benign Het
Apip C A 2: 102,922,226 (GRCm39) Y197* probably null Het
Arhgef11 T G 3: 87,635,901 (GRCm39) V925G probably damaging Het
Arid4b T C 13: 14,362,062 (GRCm39) V929A probably damaging Het
Asah2 T A 19: 32,030,306 (GRCm39) D122V probably benign Het
B2m A T 2: 121,982,128 (GRCm39) D116V possibly damaging Het
Bhmt-ps1 A G 4: 26,369,184 (GRCm39) noncoding transcript Het
Cacna1g T A 11: 94,334,899 (GRCm39) I803F probably damaging Het
Ccdc43 A T 11: 102,581,111 (GRCm39) V113E probably damaging Het
Cenpj A T 14: 56,772,238 (GRCm39) Y388* probably null Het
Chd3 G A 11: 69,245,034 (GRCm39) probably benign Het
Chil3 C T 3: 106,071,524 (GRCm39) D47N possibly damaging Het
Colgalt2 A G 1: 152,375,710 (GRCm39) T361A possibly damaging Het
Cops3 C A 11: 59,726,193 (GRCm39) probably benign Het
Crb2 G T 2: 37,673,326 (GRCm39) G74V probably damaging Het
Cspg4b G T 13: 113,464,196 (GRCm39) G1453C probably damaging Het
Cyp20a1 A T 1: 60,405,878 (GRCm39) Y224F probably damaging Het
Diaph3 A G 14: 87,378,602 (GRCm39) probably benign Het
Dnah3 A T 7: 119,550,904 (GRCm39) Y3127* probably null Het
Eef1akmt3 A C 10: 126,877,224 (GRCm39) S14A possibly damaging Het
Eps8l1 G A 7: 4,463,915 (GRCm39) R13Q possibly damaging Het
Frem2 A C 3: 53,563,736 (GRCm39) V257G possibly damaging Het
Gc T C 5: 89,587,448 (GRCm39) T259A probably benign Het
Gm4952 A T 19: 12,604,376 (GRCm39) N263Y probably benign Het
Gpcpd1 T A 2: 132,388,794 (GRCm39) H326L probably damaging Het
Helz T C 11: 107,510,994 (GRCm39) F617L probably damaging Het
Hoxb4 T C 11: 96,209,662 (GRCm39) Y23H probably damaging Het
Hsf4 T A 8: 105,999,330 (GRCm39) probably null Het
Ift56 A T 6: 38,368,475 (GRCm39) Y174F probably damaging Het
Ighv1-81 T C 12: 115,883,924 (GRCm39) D109G probably damaging Het
Irx4 T C 13: 73,417,032 (GRCm39) V476A probably benign Het
Katnb1 T A 8: 95,823,922 (GRCm39) probably null Het
L3mbtl1 A G 2: 162,807,692 (GRCm39) Y490C probably damaging Het
Lemd2 A G 17: 27,412,806 (GRCm39) probably null Het
Lrrc38 A T 4: 143,096,438 (GRCm39) T250S probably damaging Het
Map3k8 A T 18: 4,349,215 (GRCm39) Y34* probably null Het
Mgst1 T A 6: 138,130,507 (GRCm39) F79I probably benign Het
Midn T C 10: 79,991,189 (GRCm39) S357P probably benign Het
Mmp3 T A 9: 7,447,640 (GRCm39) D208E probably benign Het
Mrps26 A G 2: 130,406,862 (GRCm39) E163G probably damaging Het
Mycbpap A T 11: 94,393,983 (GRCm39) M371K probably benign Het
Mynn A C 3: 30,661,191 (GRCm39) N91T probably damaging Het
Nek11 A G 9: 105,177,265 (GRCm39) L292P probably damaging Het
Nid1 A T 13: 13,684,596 (GRCm39) R1228W probably damaging Het
Nphs2 T C 1: 156,148,499 (GRCm39) Y121H probably damaging Het
Or1f19 T G 16: 3,410,299 (GRCm39) L13R probably damaging Het
Or4p7 G A 2: 88,222,284 (GRCm39) R231H probably benign Het
Or5ac22 C A 16: 59,135,236 (GRCm39) C178F probably damaging Het
Or5ap2 T A 2: 85,680,237 (GRCm39) I147N probably benign Het
Or5d38 A C 2: 87,954,684 (GRCm39) I215S probably benign Het
Or7e176 T C 9: 20,171,313 (GRCm39) I59T probably damaging Het
Or9q2 T C 19: 13,772,915 (GRCm39) H20R probably benign Het
P2rx7 C T 5: 122,808,542 (GRCm39) T308M probably damaging Het
Prdx6 C T 1: 161,069,263 (GRCm39) probably benign Het
Rad54b T A 4: 11,615,579 (GRCm39) D862E probably damaging Het
Ripor1 A G 8: 106,343,814 (GRCm39) Y344C probably damaging Het
Rnf112 T C 11: 61,344,291 (GRCm39) M43V probably benign Het
Rp1l1 A G 14: 64,269,655 (GRCm39) N1747S probably benign Het
Rps27 A G 3: 90,120,306 (GRCm39) V22A probably damaging Het
Spaca1 A G 4: 34,044,236 (GRCm39) V86A possibly damaging Het
Spdef A G 17: 27,937,136 (GRCm39) Y156H probably damaging Het
Specc1 A C 11: 62,009,784 (GRCm39) E433D possibly damaging Het
Srpra T A 9: 35,126,326 (GRCm39) F506L probably benign Het
Stxbp5 A G 10: 9,636,610 (GRCm39) probably benign Het
Syne1 C T 10: 5,002,777 (GRCm39) R8046Q probably damaging Het
Tbx5 T A 5: 120,021,090 (GRCm39) S365R probably benign Het
Terb1 G T 8: 105,174,580 (GRCm39) P698Q probably benign Het
Tmbim7 T A 5: 3,711,948 (GRCm39) Y27* probably null Het
Tmem106c C A 15: 97,862,909 (GRCm39) A60E possibly damaging Het
Ttc6 T A 12: 57,720,609 (GRCm39) probably null Het
Ttn T C 2: 76,562,714 (GRCm39) I28747V possibly damaging Het
Unc13a C T 8: 72,083,148 (GRCm39) probably null Het
Wdr81 T C 11: 75,342,750 (GRCm39) D839G probably benign Het
Wfdc15a G C 2: 164,041,725 (GRCm39) Q33E probably benign Het
Zfp456 T C 13: 67,515,065 (GRCm39) R214G probably benign Het
Zfp457 T A 13: 67,442,164 (GRCm39) Y137F probably damaging Het
Other mutations in Ehf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Ehf APN 2 103,097,185 (GRCm39) splice site probably null
IGL01296:Ehf APN 2 103,098,500 (GRCm39) splice site probably null
IGL02095:Ehf APN 2 103,097,336 (GRCm39) missense probably damaging 1.00
R0399:Ehf UTSW 2 103,097,215 (GRCm39) missense probably damaging 1.00
R1116:Ehf UTSW 2 103,097,354 (GRCm39) missense probably damaging 1.00
R1728:Ehf UTSW 2 103,104,251 (GRCm39) missense possibly damaging 0.51
R1729:Ehf UTSW 2 103,104,251 (GRCm39) missense possibly damaging 0.51
R2240:Ehf UTSW 2 103,104,420 (GRCm39) missense probably benign
R2287:Ehf UTSW 2 103,097,469 (GRCm39) missense possibly damaging 0.89
R2397:Ehf UTSW 2 103,107,164 (GRCm39) missense probably damaging 0.99
R4094:Ehf UTSW 2 103,121,095 (GRCm39) intron probably benign
R4687:Ehf UTSW 2 103,097,471 (GRCm39) missense probably damaging 1.00
R5695:Ehf UTSW 2 103,097,124 (GRCm39) missense probably damaging 1.00
R5925:Ehf UTSW 2 103,097,338 (GRCm39) splice site probably null
R6656:Ehf UTSW 2 103,113,928 (GRCm39) missense probably damaging 1.00
R8217:Ehf UTSW 2 103,109,976 (GRCm39) missense possibly damaging 0.94
R9008:Ehf UTSW 2 103,097,173 (GRCm39) missense
Z1176:Ehf UTSW 2 103,109,863 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CGTCAGAAGTAGATTTTCTTTGTCCC -3'
(R):5'- TCCTGAAGTCAGAAGCTGTGG -3'

Sequencing Primer
(F):5'- AGTAGATTTTCTTTGTCCCTTCATGG -3'
(R):5'- CTGTGGCTCAGCTGTGG -3'
Posted On 2016-04-15