Incidental Mutation 'R0400:Skint9'
ID38113
Institutional Source Beutler Lab
Gene Symbol Skint9
Ensembl Gene ENSMUSG00000049972
Gene Nameselection and upkeep of intraepithelial T cells 9
Synonyms
MMRRC Submission 038605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R0400 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112385969-112433985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112414001 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 71 (S71P)
Ref Sequence ENSEMBL: ENSMUSP00000052670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058605]
Predicted Effect probably damaging
Transcript: ENSMUST00000058605
AA Change: S71P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052670
Gene: ENSMUSG00000049972
AA Change: S71P

DomainStartEndE-ValueType
PDB:4F8T|A 26 125 1e-9 PDB
Blast:IG_like 32 119 8e-12 BLAST
SCOP:d1eula_ 154 245 5e-3 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik T A 11: 30,426,360 H169L probably benign Het
9130230L23Rik T C 5: 65,990,356 D28G unknown Het
Abca12 T A 1: 71,259,776 probably benign Het
Acsl5 T C 19: 55,293,711 V573A probably damaging Het
Agap1 A G 1: 89,843,250 probably benign Het
Arid2 A G 15: 96,356,925 probably benign Het
B430305J03Rik T A 3: 61,364,135 probably benign Het
Brsk2 T C 7: 141,998,553 L584P probably damaging Het
C2cd4c A G 10: 79,613,209 Y35H probably damaging Het
Cacul1 A G 19: 60,563,153 probably benign Het
Cers3 T C 7: 66,764,330 V88A probably benign Het
Cnnm1 A T 19: 43,468,364 H614L probably damaging Het
Col1a1 T A 11: 94,941,369 probably benign Het
Cyp1b1 T A 17: 79,713,587 D242V probably damaging Het
Cyp4a31 T C 4: 115,563,718 M1T probably null Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dclk2 A T 3: 86,813,747 probably null Het
Ddx58 A G 4: 40,235,257 Y78H probably benign Het
Dnah17 A G 11: 118,082,078 S2010P probably damaging Het
Dram2 T C 3: 106,573,618 L246P probably damaging Het
Dus2 A T 8: 106,048,677 T279S probably benign Het
Epn2 T C 11: 61,532,696 probably null Het
Esco2 C A 14: 65,831,706 V52F possibly damaging Het
Fbp1 T A 13: 62,865,068 T104S probably benign Het
Foxj2 A T 6: 122,833,808 Q249L possibly damaging Het
Galnt7 T C 8: 57,583,989 Y122C probably damaging Het
Gimd1 T C 3: 132,634,827 Y35H probably benign Het
Gipc2 A G 3: 152,165,668 F74L probably damaging Het
Glt1d1 T A 5: 127,657,075 probably benign Het
Hmcn2 A G 2: 31,400,129 T2325A probably damaging Het
Iffo1 A G 6: 125,153,471 K471R probably damaging Het
Ireb2 G A 9: 54,896,498 R491H probably benign Het
Isg20 A G 7: 78,916,725 N141D possibly damaging Het
Kmt5c G A 7: 4,746,244 R100H probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrn4 A C 2: 132,878,020 F287V probably benign Het
Mmrn1 A C 6: 60,977,115 K793N probably benign Het
Muc16 A G 9: 18,510,534 V8227A possibly damaging Het
Myh2 C T 11: 67,192,598 probably benign Het
Nalcn T A 14: 123,290,960 probably benign Het
Nfia T C 4: 98,063,136 V400A probably damaging Het
Nxph4 T A 10: 127,526,258 T255S possibly damaging Het
Olfm5 G A 7: 104,154,179 T359I probably damaging Het
Olfr141 A G 2: 86,806,651 M116T probably damaging Het
Olfr393 T C 11: 73,848,041 Y28C probably benign Het
Olfr907 A G 9: 38,498,911 M81V possibly damaging Het
Olfr935 G T 9: 38,995,198 P79Q probably damaging Het
Pak7 T C 2: 136,097,579 I545M possibly damaging Het
Pcdhb15 T C 18: 37,475,895 F727L probably benign Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Phlpp1 T A 1: 106,392,934 I1553N probably benign Het
Pink1 T C 4: 138,317,918 T282A probably damaging Het
Prdm2 A G 4: 143,111,670 F1706S probably benign Het
Pycr1 G A 11: 120,641,526 probably benign Het
Smad1 A G 8: 79,371,770 probably benign Het
Snapc5 A T 9: 64,180,507 E33D probably damaging Het
Snrnp40 T C 4: 130,362,650 L56P probably damaging Het
Stab2 A C 10: 86,872,610 I1697S probably damaging Het
Tfap2a G T 13: 40,717,412 probably benign Het
Tmem57 T C 4: 134,828,116 K349E probably benign Het
Tph2 A G 10: 115,080,120 probably benign Het
Triml1 A G 8: 43,141,040 V118A probably benign Het
Ttbk2 T A 2: 120,750,242 T538S probably benign Het
Ttn A G 2: 76,715,272 V32569A possibly damaging Het
U2af1 T A 17: 31,648,192 Y158F probably benign Het
Usp7 A T 16: 8,716,632 probably benign Het
Vdr A G 15: 97,869,351 S179P probably benign Het
Vps13d A C 4: 145,065,827 S663A probably benign Het
Wdr62 T A 7: 30,241,462 T844S possibly damaging Het
Wipi1 C T 11: 109,577,130 R407Q probably damaging Het
Zbtb43 A G 2: 33,453,897 C439R probably damaging Het
Zfp507 T A 7: 35,791,746 H704L probably damaging Het
Zzef1 G A 11: 72,895,242 R2080K probably damaging Het
Other mutations in Skint9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02399:Skint9 APN 4 112389250 missense possibly damaging 0.88
IGL02417:Skint9 APN 4 112414138 splice site probably benign
IGL03111:Skint9 APN 4 112391724 missense probably benign 0.01
land_lubber UTSW 4 112390977 nonsense probably null
R0390:Skint9 UTSW 4 112389179 missense probably benign 0.21
R1606:Skint9 UTSW 4 112389201 missense probably benign 0.02
R1757:Skint9 UTSW 4 112413962 missense probably benign 0.03
R2431:Skint9 UTSW 4 112389267 missense probably damaging 1.00
R3195:Skint9 UTSW 4 112390951 missense probably benign 0.37
R3196:Skint9 UTSW 4 112390951 missense probably benign 0.37
R4329:Skint9 UTSW 4 112391865 missense probably damaging 0.98
R4855:Skint9 UTSW 4 112391011 missense probably benign
R4986:Skint9 UTSW 4 112391713 missense probably benign 0.00
R5093:Skint9 UTSW 4 112389250 missense probably benign 0.01
R5844:Skint9 UTSW 4 112413883 missense probably benign 0.01
R5897:Skint9 UTSW 4 112413916 missense possibly damaging 0.95
R7123:Skint9 UTSW 4 112390977 nonsense probably null
R7406:Skint9 UTSW 4 112389231 missense probably benign 0.00
R7591:Skint9 UTSW 4 112390950 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAATATGGCCTTTCCCCTGTTACCT -3'
(R):5'- CGCACACAGAATCATAATGCCATCTCTA -3'

Sequencing Primer
(F):5'- tttcaacttctcagccttttctc -3'
(R):5'- ATCCTCTTCCTAGCTATGAGATCAG -3'
Posted On2013-05-23