Incidental Mutation 'R4930:Mynn'
ID381134
Institutional Source Beutler Lab
Gene Symbol Mynn
Ensembl Gene ENSMUSG00000037730
Gene Namemyoneurin
SynonymsSBBIZ1, 2810011C24Rik
MMRRC Submission 042531-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R4930 (G1)
Quality Score199
Status Validated
Chromosome3
Chromosomal Location30602065-30619873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30607042 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 91 (N91T)
Ref Sequence ENSEMBL: ENSMUSP00000141951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047502] [ENSMUST00000192715] [ENSMUST00000195396] [ENSMUST00000195751]
Predicted Effect probably damaging
Transcript: ENSMUST00000047502
AA Change: N91T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041034
Gene: ENSMUSG00000037730
AA Change: N91T

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192715
AA Change: N91T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141951
Gene: ENSMUSG00000037730
AA Change: N91T

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194587
Predicted Effect probably benign
Transcript: ENSMUST00000195396
AA Change: M48L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000141623
Gene: ENSMUSG00000037730
AA Change: M48L

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195751
AA Change: M48L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000141450
Gene: ENSMUSG00000037730
AA Change: M48L

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Meta Mutation Damage Score 0.4339 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BTB/POZ and zinc finger domain-containing protein family that are involved in the control of gene expression. Alternative splicing results in multiple transcript variants and a pseudogene has been identified on chromosome 14. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C T 12: 72,906,234 E242K possibly damaging Het
A930011G23Rik A G 5: 99,222,404 M499T possibly damaging Het
Abcb8 G A 5: 24,400,781 V196M possibly damaging Het
Ahnak T C 19: 9,010,967 M3205T possibly damaging Het
Ankrd1 A G 19: 36,115,033 Y265H probably damaging Het
Apeh A G 9: 108,087,825 S446P probably benign Het
Apip C A 2: 103,091,881 Y197* probably null Het
Arhgef11 T G 3: 87,728,594 V925G probably damaging Het
Arid4b T C 13: 14,187,477 V929A probably damaging Het
Asah2 T A 19: 32,052,906 D122V probably benign Het
B2m A T 2: 122,151,647 D116V possibly damaging Het
BC067074 G T 13: 113,327,662 G1453C probably damaging Het
Bhmt-ps1 A G 4: 26,369,184 noncoding transcript Het
Cacna1g T A 11: 94,444,073 I803F probably damaging Het
Ccdc43 A T 11: 102,690,285 V113E probably damaging Het
Cenpj A T 14: 56,534,781 Y388* probably null Het
Chd3 G A 11: 69,354,208 probably benign Het
Chil3 C T 3: 106,164,208 D47N possibly damaging Het
Colgalt2 A G 1: 152,499,959 T361A possibly damaging Het
Cops3 C A 11: 59,835,367 probably benign Het
Crb2 G T 2: 37,783,314 G74V probably damaging Het
Cyp20a1 A T 1: 60,366,719 Y224F probably damaging Het
Diaph3 A G 14: 87,141,166 probably benign Het
Dnah3 A T 7: 119,951,681 Y3127* probably null Het
Eef1akmt3 A C 10: 127,041,355 S14A possibly damaging Het
Ehf C A 2: 103,266,857 R250L probably damaging Het
Eps8l1 G A 7: 4,460,916 R13Q possibly damaging Het
Frem2 A C 3: 53,656,315 V257G possibly damaging Het
Gc T C 5: 89,439,589 T259A probably benign Het
Gm4952 A T 19: 12,627,012 N263Y probably benign Het
Gpcpd1 T A 2: 132,546,874 H326L probably damaging Het
Helz T C 11: 107,620,168 F617L probably damaging Het
Hoxb4 T C 11: 96,318,836 Y23H probably damaging Het
Hsf4 T A 8: 105,272,698 probably null Het
Ighv1-81 T C 12: 115,920,304 D109G probably damaging Het
Irx4 T C 13: 73,268,913 V476A probably benign Het
Katnb1 T A 8: 95,097,294 probably null Het
L3mbtl1 A G 2: 162,965,772 Y490C probably damaging Het
Lemd2 A G 17: 27,193,832 probably null Het
Lrrc38 A T 4: 143,369,868 T250S probably damaging Het
Map3k8 A T 18: 4,349,215 Y34* probably null Het
Mgst1 T A 6: 138,153,509 F79I probably benign Het
Midn T C 10: 80,155,355 S357P probably benign Het
Mmp3 T A 9: 7,447,640 D208E probably benign Het
Mrps26 A G 2: 130,564,942 E163G probably damaging Het
Mycbpap A T 11: 94,503,157 M371K probably benign Het
Nek11 A G 9: 105,300,066 L292P probably damaging Het
Nid1 A T 13: 13,510,011 R1228W probably damaging Het
Nphs2 T C 1: 156,320,929 Y121H probably damaging Het
Olfr1020 T A 2: 85,849,893 I147N probably benign Het
Olfr1166 A C 2: 88,124,340 I215S probably benign Het
Olfr1178 G A 2: 88,391,940 R231H probably benign Het
Olfr1497 T C 19: 13,795,551 H20R probably benign Het
Olfr161 T G 16: 3,592,435 L13R probably damaging Het
Olfr204 C A 16: 59,314,873 C178F probably damaging Het
Olfr872 T C 9: 20,260,017 I59T probably damaging Het
P2rx7 C T 5: 122,670,479 T308M probably damaging Het
Prdx6 C T 1: 161,241,693 probably benign Het
Rad54b T A 4: 11,615,579 D862E probably damaging Het
Ripor1 A G 8: 105,617,182 Y344C probably damaging Het
Rnf112 T C 11: 61,453,465 M43V probably benign Het
Rp1l1 A G 14: 64,032,206 N1747S probably benign Het
Rps27 A G 3: 90,212,999 V22A probably damaging Het
Spaca1 A G 4: 34,044,236 V86A possibly damaging Het
Spdef A G 17: 27,718,162 Y156H probably damaging Het
Specc1 A C 11: 62,118,958 E433D possibly damaging Het
Srpr T A 9: 35,215,030 F506L probably benign Het
Stxbp5 A G 10: 9,760,866 probably benign Het
Syne1 C T 10: 5,052,777 R8046Q probably damaging Het
Tbx5 T A 5: 119,883,025 S365R probably benign Het
Terb1 G T 8: 104,447,948 P698Q probably benign Het
Tmbim7 T A 5: 3,661,948 Y27* probably null Het
Tmem106c C A 15: 97,965,028 A60E possibly damaging Het
Ttc26 A T 6: 38,391,540 Y174F probably damaging Het
Ttc6 T A 12: 57,673,823 probably null Het
Ttn T C 2: 76,732,370 I28747V possibly damaging Het
Unc13a C T 8: 71,630,504 probably null Het
Wdr81 T C 11: 75,451,924 D839G probably benign Het
Wfdc15a G C 2: 164,199,805 Q33E probably benign Het
Zfp456 T C 13: 67,366,946 R214G probably benign Het
Zfp457 T A 13: 67,294,100 Y137F probably damaging Het
Other mutations in Mynn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Mynn APN 3 30613606 missense probably damaging 0.99
IGL01544:Mynn APN 3 30607705 nonsense probably null
IGL02084:Mynn APN 3 30611615 missense probably damaging 1.00
IGL02189:Mynn APN 3 30613544 splice site probably benign
IGL02261:Mynn APN 3 30607131 missense possibly damaging 0.67
IGL02541:Mynn APN 3 30611603 missense probably damaging 0.98
IGL02681:Mynn APN 3 30616642 missense probably benign 0.36
IGL03167:Mynn APN 3 30609042 missense probably damaging 1.00
PIT4494001:Mynn UTSW 3 30607722 nonsense probably null
R0049:Mynn UTSW 3 30607081 makesense probably null
R0321:Mynn UTSW 3 30607557 missense probably benign 0.01
R0420:Mynn UTSW 3 30607459 missense probably benign 0.42
R0574:Mynn UTSW 3 30616739 missense probably benign 0.01
R0576:Mynn UTSW 3 30607068 missense probably damaging 1.00
R1460:Mynn UTSW 3 30603704 missense probably damaging 0.99
R1882:Mynn UTSW 3 30616813 makesense probably null
R3115:Mynn UTSW 3 30607810 missense probably damaging 1.00
R3442:Mynn UTSW 3 30613563 missense probably damaging 0.99
R5153:Mynn UTSW 3 30611589 missense probably benign 0.00
R5351:Mynn UTSW 3 30607542 missense probably benign 0.01
R7446:Mynn UTSW 3 30607052 missense probably benign 0.01
R7468:Mynn UTSW 3 30603676 missense probably damaging 1.00
R7543:Mynn UTSW 3 30607039 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAGATACCTACTCAAACATTCTGAG -3'
(R):5'- GGAGACTTCTGATTTCTCCCGATTG -3'

Sequencing Primer
(F):5'- GTACAGCtgtttctggttt -3'
(R):5'- CCCGATTGTTATAATCTCGCAGGG -3'
Posted On2016-04-15