Incidental Mutation 'R4930:Frem2'
ID 381135
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene Name Fras1 related extracellular matrix protein 2
Synonyms 8430406N05Rik, ne, 6030440P17Rik, b2b1562Clo, my
MMRRC Submission 042531-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4930 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 53421359-53564776 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 53563736 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 257 (V257G)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000091137
AA Change: V257G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: V257G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199323
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C T 12: 72,953,008 (GRCm39) E242K possibly damaging Het
A930011G23Rik A G 5: 99,370,263 (GRCm39) M499T possibly damaging Het
Abcb8 G A 5: 24,605,779 (GRCm39) V196M possibly damaging Het
Ahnak T C 19: 8,988,331 (GRCm39) M3205T possibly damaging Het
Ankrd1 A G 19: 36,092,433 (GRCm39) Y265H probably damaging Het
Apeh A G 9: 107,965,024 (GRCm39) S446P probably benign Het
Apip C A 2: 102,922,226 (GRCm39) Y197* probably null Het
Arhgef11 T G 3: 87,635,901 (GRCm39) V925G probably damaging Het
Arid4b T C 13: 14,362,062 (GRCm39) V929A probably damaging Het
Asah2 T A 19: 32,030,306 (GRCm39) D122V probably benign Het
B2m A T 2: 121,982,128 (GRCm39) D116V possibly damaging Het
Bhmt-ps1 A G 4: 26,369,184 (GRCm39) noncoding transcript Het
Cacna1g T A 11: 94,334,899 (GRCm39) I803F probably damaging Het
Ccdc43 A T 11: 102,581,111 (GRCm39) V113E probably damaging Het
Cenpj A T 14: 56,772,238 (GRCm39) Y388* probably null Het
Chd3 G A 11: 69,245,034 (GRCm39) probably benign Het
Chil3 C T 3: 106,071,524 (GRCm39) D47N possibly damaging Het
Colgalt2 A G 1: 152,375,710 (GRCm39) T361A possibly damaging Het
Cops3 C A 11: 59,726,193 (GRCm39) probably benign Het
Crb2 G T 2: 37,673,326 (GRCm39) G74V probably damaging Het
Cspg4b G T 13: 113,464,196 (GRCm39) G1453C probably damaging Het
Cyp20a1 A T 1: 60,405,878 (GRCm39) Y224F probably damaging Het
Diaph3 A G 14: 87,378,602 (GRCm39) probably benign Het
Dnah3 A T 7: 119,550,904 (GRCm39) Y3127* probably null Het
Eef1akmt3 A C 10: 126,877,224 (GRCm39) S14A possibly damaging Het
Ehf C A 2: 103,097,202 (GRCm39) R250L probably damaging Het
Eps8l1 G A 7: 4,463,915 (GRCm39) R13Q possibly damaging Het
Gc T C 5: 89,587,448 (GRCm39) T259A probably benign Het
Gm4952 A T 19: 12,604,376 (GRCm39) N263Y probably benign Het
Gpcpd1 T A 2: 132,388,794 (GRCm39) H326L probably damaging Het
Helz T C 11: 107,510,994 (GRCm39) F617L probably damaging Het
Hoxb4 T C 11: 96,209,662 (GRCm39) Y23H probably damaging Het
Hsf4 T A 8: 105,999,330 (GRCm39) probably null Het
Ift56 A T 6: 38,368,475 (GRCm39) Y174F probably damaging Het
Ighv1-81 T C 12: 115,883,924 (GRCm39) D109G probably damaging Het
Irx4 T C 13: 73,417,032 (GRCm39) V476A probably benign Het
Katnb1 T A 8: 95,823,922 (GRCm39) probably null Het
L3mbtl1 A G 2: 162,807,692 (GRCm39) Y490C probably damaging Het
Lemd2 A G 17: 27,412,806 (GRCm39) probably null Het
Lrrc38 A T 4: 143,096,438 (GRCm39) T250S probably damaging Het
Map3k8 A T 18: 4,349,215 (GRCm39) Y34* probably null Het
Mgst1 T A 6: 138,130,507 (GRCm39) F79I probably benign Het
Midn T C 10: 79,991,189 (GRCm39) S357P probably benign Het
Mmp3 T A 9: 7,447,640 (GRCm39) D208E probably benign Het
Mrps26 A G 2: 130,406,862 (GRCm39) E163G probably damaging Het
Mycbpap A T 11: 94,393,983 (GRCm39) M371K probably benign Het
Mynn A C 3: 30,661,191 (GRCm39) N91T probably damaging Het
Nek11 A G 9: 105,177,265 (GRCm39) L292P probably damaging Het
Nid1 A T 13: 13,684,596 (GRCm39) R1228W probably damaging Het
Nphs2 T C 1: 156,148,499 (GRCm39) Y121H probably damaging Het
Or1f19 T G 16: 3,410,299 (GRCm39) L13R probably damaging Het
Or4p7 G A 2: 88,222,284 (GRCm39) R231H probably benign Het
Or5ac22 C A 16: 59,135,236 (GRCm39) C178F probably damaging Het
Or5ap2 T A 2: 85,680,237 (GRCm39) I147N probably benign Het
Or5d38 A C 2: 87,954,684 (GRCm39) I215S probably benign Het
Or7e176 T C 9: 20,171,313 (GRCm39) I59T probably damaging Het
Or9q2 T C 19: 13,772,915 (GRCm39) H20R probably benign Het
P2rx7 C T 5: 122,808,542 (GRCm39) T308M probably damaging Het
Prdx6 C T 1: 161,069,263 (GRCm39) probably benign Het
Rad54b T A 4: 11,615,579 (GRCm39) D862E probably damaging Het
Ripor1 A G 8: 106,343,814 (GRCm39) Y344C probably damaging Het
Rnf112 T C 11: 61,344,291 (GRCm39) M43V probably benign Het
Rp1l1 A G 14: 64,269,655 (GRCm39) N1747S probably benign Het
Rps27 A G 3: 90,120,306 (GRCm39) V22A probably damaging Het
Spaca1 A G 4: 34,044,236 (GRCm39) V86A possibly damaging Het
Spdef A G 17: 27,937,136 (GRCm39) Y156H probably damaging Het
Specc1 A C 11: 62,009,784 (GRCm39) E433D possibly damaging Het
Srpra T A 9: 35,126,326 (GRCm39) F506L probably benign Het
Stxbp5 A G 10: 9,636,610 (GRCm39) probably benign Het
Syne1 C T 10: 5,002,777 (GRCm39) R8046Q probably damaging Het
Tbx5 T A 5: 120,021,090 (GRCm39) S365R probably benign Het
Terb1 G T 8: 105,174,580 (GRCm39) P698Q probably benign Het
Tmbim7 T A 5: 3,711,948 (GRCm39) Y27* probably null Het
Tmem106c C A 15: 97,862,909 (GRCm39) A60E possibly damaging Het
Ttc6 T A 12: 57,720,609 (GRCm39) probably null Het
Ttn T C 2: 76,562,714 (GRCm39) I28747V possibly damaging Het
Unc13a C T 8: 72,083,148 (GRCm39) probably null Het
Wdr81 T C 11: 75,342,750 (GRCm39) D839G probably benign Het
Wfdc15a G C 2: 164,041,725 (GRCm39) Q33E probably benign Het
Zfp456 T C 13: 67,515,065 (GRCm39) R214G probably benign Het
Zfp457 T A 13: 67,442,164 (GRCm39) Y137F probably damaging Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53,493,016 (GRCm39) missense probably damaging 1.00
IGL00911:Frem2 APN 3 53,479,883 (GRCm39) missense probably damaging 1.00
IGL01322:Frem2 APN 3 53,448,459 (GRCm39) missense probably benign 0.00
IGL01330:Frem2 APN 3 53,562,662 (GRCm39) missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53,433,317 (GRCm39) missense probably damaging 1.00
IGL01556:Frem2 APN 3 53,442,702 (GRCm39) missense probably benign 0.23
IGL01580:Frem2 APN 3 53,562,596 (GRCm39) missense probably damaging 1.00
IGL01606:Frem2 APN 3 53,561,012 (GRCm39) missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53,563,130 (GRCm39) missense probably benign 0.00
IGL01648:Frem2 APN 3 53,443,153 (GRCm39) missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53,424,434 (GRCm39) missense probably damaging 1.00
IGL01665:Frem2 APN 3 53,457,083 (GRCm39) missense probably benign 0.07
IGL01670:Frem2 APN 3 53,564,358 (GRCm39) missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53,429,725 (GRCm39) missense probably benign 0.33
IGL02175:Frem2 APN 3 53,563,020 (GRCm39) missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53,427,061 (GRCm39) missense probably benign 0.35
IGL02202:Frem2 APN 3 53,562,220 (GRCm39) missense probably benign 0.00
IGL02427:Frem2 APN 3 53,443,184 (GRCm39) missense probably damaging 0.97
IGL02457:Frem2 APN 3 53,428,470 (GRCm39) missense probably damaging 0.99
IGL02638:Frem2 APN 3 53,458,767 (GRCm39) missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53,559,596 (GRCm39) missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53,563,049 (GRCm39) missense probably benign 0.40
IGL03169:Frem2 APN 3 53,429,713 (GRCm39) missense probably benign 0.01
IGL03238:Frem2 APN 3 53,563,682 (GRCm39) missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53,479,729 (GRCm39) missense probably benign 0.01
IGL03273:Frem2 APN 3 53,444,930 (GRCm39) nonsense probably null
IGL03343:Frem2 APN 3 53,559,674 (GRCm39) missense probably damaging 1.00
Biosimilar UTSW 3 53,561,744 (GRCm39) missense probably benign 0.01
Fruit_stripe UTSW 3 53,444,910 (GRCm39) missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53,560,622 (GRCm39) missense probably damaging 0.98
R0019:Frem2 UTSW 3 53,431,099 (GRCm39) missense probably damaging 0.99
R0092:Frem2 UTSW 3 53,497,217 (GRCm39) missense probably benign 0.03
R0108:Frem2 UTSW 3 53,555,382 (GRCm39) missense probably benign 0.03
R0115:Frem2 UTSW 3 53,563,629 (GRCm39) missense probably damaging 0.99
R0118:Frem2 UTSW 3 53,442,664 (GRCm39) nonsense probably null
R0374:Frem2 UTSW 3 53,561,381 (GRCm39) missense probably damaging 1.00
R0437:Frem2 UTSW 3 53,560,436 (GRCm39) missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53,427,375 (GRCm39) missense probably damaging 1.00
R0555:Frem2 UTSW 3 53,424,281 (GRCm39) missense probably damaging 0.97
R0564:Frem2 UTSW 3 53,563,530 (GRCm39) missense probably damaging 0.97
R0586:Frem2 UTSW 3 53,555,342 (GRCm39) missense probably damaging 0.99
R0726:Frem2 UTSW 3 53,427,047 (GRCm39) missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53,561,394 (GRCm39) missense probably benign
R1233:Frem2 UTSW 3 53,455,199 (GRCm39) missense probably damaging 0.98
R1302:Frem2 UTSW 3 53,562,959 (GRCm39) missense probably benign 0.00
R1333:Frem2 UTSW 3 53,457,152 (GRCm39) missense probably benign 0.26
R1446:Frem2 UTSW 3 53,562,017 (GRCm39) missense probably benign 0.31
R1523:Frem2 UTSW 3 53,562,828 (GRCm39) missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53,561,631 (GRCm39) missense probably benign 0.19
R1543:Frem2 UTSW 3 53,479,876 (GRCm39) missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53,561,940 (GRCm39) missense probably benign 0.19
R1600:Frem2 UTSW 3 53,455,144 (GRCm39) missense probably damaging 1.00
R1678:Frem2 UTSW 3 53,427,359 (GRCm39) missense probably damaging 1.00
R1687:Frem2 UTSW 3 53,561,373 (GRCm39) missense probably benign
R1696:Frem2 UTSW 3 53,563,463 (GRCm39) nonsense probably null
R1758:Frem2 UTSW 3 53,560,778 (GRCm39) missense probably damaging 1.00
R1857:Frem2 UTSW 3 53,562,294 (GRCm39) missense probably benign 0.10
R1869:Frem2 UTSW 3 53,442,617 (GRCm39) missense probably benign 0.04
R1921:Frem2 UTSW 3 53,560,916 (GRCm39) missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53,559,653 (GRCm39) missense probably benign 0.01
R2045:Frem2 UTSW 3 53,443,165 (GRCm39) missense probably damaging 1.00
R2113:Frem2 UTSW 3 53,560,343 (GRCm39) missense probably damaging 1.00
R2152:Frem2 UTSW 3 53,424,450 (GRCm39) nonsense probably null
R2164:Frem2 UTSW 3 53,444,751 (GRCm39) missense probably damaging 1.00
R2181:Frem2 UTSW 3 53,482,008 (GRCm39) missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53,423,994 (GRCm39) missense probably benign
R2221:Frem2 UTSW 3 53,424,278 (GRCm39) missense probably benign 0.00
R2255:Frem2 UTSW 3 53,559,935 (GRCm39) missense probably damaging 0.96
R2280:Frem2 UTSW 3 53,479,844 (GRCm39) missense probably damaging 1.00
R3196:Frem2 UTSW 3 53,444,752 (GRCm39) missense probably damaging 1.00
R3716:Frem2 UTSW 3 53,479,781 (GRCm39) missense probably damaging 1.00
R3807:Frem2 UTSW 3 53,560,870 (GRCm39) missense probably benign 0.22
R3820:Frem2 UTSW 3 53,424,270 (GRCm39) missense probably damaging 1.00
R3821:Frem2 UTSW 3 53,559,836 (GRCm39) missense probably damaging 1.00
R3977:Frem2 UTSW 3 53,559,491 (GRCm39) missense probably benign 0.00
R3979:Frem2 UTSW 3 53,559,491 (GRCm39) missense probably benign 0.00
R4014:Frem2 UTSW 3 53,559,774 (GRCm39) missense probably benign 0.01
R4127:Frem2 UTSW 3 53,433,317 (GRCm39) missense probably damaging 1.00
R4195:Frem2 UTSW 3 53,446,689 (GRCm39) missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53,446,689 (GRCm39) missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53,452,923 (GRCm39) missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53,446,583 (GRCm39) critical splice donor site probably null
R4428:Frem2 UTSW 3 53,561,759 (GRCm39) missense probably benign 0.40
R4559:Frem2 UTSW 3 53,561,742 (GRCm39) missense probably benign 0.01
R4600:Frem2 UTSW 3 53,455,228 (GRCm39) missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53,455,228 (GRCm39) missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53,455,228 (GRCm39) missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53,455,228 (GRCm39) missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53,562,864 (GRCm39) missense probably damaging 1.00
R4678:Frem2 UTSW 3 53,451,792 (GRCm39) missense probably benign 0.00
R4689:Frem2 UTSW 3 53,455,056 (GRCm39) missense probably benign 0.43
R4740:Frem2 UTSW 3 53,443,240 (GRCm39) missense probably benign 0.04
R4748:Frem2 UTSW 3 53,448,514 (GRCm39) missense probably damaging 1.00
R4790:Frem2 UTSW 3 53,424,162 (GRCm39) missense probably benign
R4809:Frem2 UTSW 3 53,561,316 (GRCm39) missense probably benign 0.01
R4971:Frem2 UTSW 3 53,446,604 (GRCm39) missense probably damaging 1.00
R5057:Frem2 UTSW 3 53,442,617 (GRCm39) missense probably benign 0.37
R5202:Frem2 UTSW 3 53,458,767 (GRCm39) missense probably benign 0.41
R5221:Frem2 UTSW 3 53,493,032 (GRCm39) missense probably damaging 1.00
R5231:Frem2 UTSW 3 53,429,716 (GRCm39) missense probably damaging 1.00
R5268:Frem2 UTSW 3 53,560,575 (GRCm39) missense probably damaging 0.96
R5480:Frem2 UTSW 3 53,563,928 (GRCm39) nonsense probably null
R5637:Frem2 UTSW 3 53,560,358 (GRCm39) missense probably damaging 0.97
R5664:Frem2 UTSW 3 53,559,911 (GRCm39) missense probably benign 0.33
R5698:Frem2 UTSW 3 53,559,926 (GRCm39) missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53,563,380 (GRCm39) missense probably damaging 1.00
R5754:Frem2 UTSW 3 53,444,679 (GRCm39) missense probably damaging 1.00
R5808:Frem2 UTSW 3 53,559,984 (GRCm39) missense probably damaging 0.96
R5840:Frem2 UTSW 3 53,555,342 (GRCm39) missense probably damaging 0.99
R5874:Frem2 UTSW 3 53,444,910 (GRCm39) missense probably benign 0.21
R6050:Frem2 UTSW 3 53,560,433 (GRCm39) missense probably damaging 0.99
R6103:Frem2 UTSW 3 53,457,209 (GRCm39) missense probably benign 0.00
R6149:Frem2 UTSW 3 53,458,762 (GRCm39) missense probably damaging 0.98
R6182:Frem2 UTSW 3 53,555,390 (GRCm39) missense probably damaging 1.00
R6191:Frem2 UTSW 3 53,562,701 (GRCm39) missense probably benign 0.10
R6245:Frem2 UTSW 3 53,563,245 (GRCm39) missense probably benign 0.00
R6252:Frem2 UTSW 3 53,479,869 (GRCm39) missense probably damaging 1.00
R6393:Frem2 UTSW 3 53,493,061 (GRCm39) missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53,479,799 (GRCm39) missense probably benign 0.01
R6595:Frem2 UTSW 3 53,457,205 (GRCm39) missense probably damaging 1.00
R6665:Frem2 UTSW 3 53,562,077 (GRCm39) missense probably damaging 1.00
R6708:Frem2 UTSW 3 53,492,922 (GRCm39) missense probably benign 0.00
R6751:Frem2 UTSW 3 53,561,086 (GRCm39) missense probably damaging 1.00
R6787:Frem2 UTSW 3 53,561,744 (GRCm39) missense probably benign 0.01
R6913:Frem2 UTSW 3 53,424,242 (GRCm39) missense probably damaging 1.00
R6916:Frem2 UTSW 3 53,455,109 (GRCm39) missense probably damaging 1.00
R7017:Frem2 UTSW 3 53,427,023 (GRCm39) missense probably benign 0.02
R7083:Frem2 UTSW 3 53,444,914 (GRCm39) missense probably damaging 0.99
R7108:Frem2 UTSW 3 53,560,934 (GRCm39) missense probably damaging 1.00
R7133:Frem2 UTSW 3 53,479,760 (GRCm39) missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53,562,174 (GRCm39) missense probably damaging 1.00
R7341:Frem2 UTSW 3 53,561,916 (GRCm39) missense probably damaging 1.00
R7455:Frem2 UTSW 3 53,479,701 (GRCm39) splice site probably null
R7487:Frem2 UTSW 3 53,561,970 (GRCm39) missense probably benign 0.40
R7495:Frem2 UTSW 3 53,424,258 (GRCm39) missense probably benign 0.13
R7542:Frem2 UTSW 3 53,560,000 (GRCm39) missense probably damaging 1.00
R7636:Frem2 UTSW 3 53,560,668 (GRCm39) missense probably benign 0.00
R7703:Frem2 UTSW 3 53,429,589 (GRCm39) missense probably benign 0.01
R7750:Frem2 UTSW 3 53,431,103 (GRCm39) missense possibly damaging 0.83
R7849:Frem2 UTSW 3 53,479,795 (GRCm39) missense probably damaging 1.00
R7922:Frem2 UTSW 3 53,560,725 (GRCm39) missense probably damaging 0.98
R8008:Frem2 UTSW 3 53,560,331 (GRCm39) missense probably damaging 1.00
R8051:Frem2 UTSW 3 53,442,776 (GRCm39) missense probably benign 0.04
R8052:Frem2 UTSW 3 53,457,064 (GRCm39) missense probably benign 0.02
R8176:Frem2 UTSW 3 53,562,761 (GRCm39) missense possibly damaging 0.50
R8220:Frem2 UTSW 3 53,563,928 (GRCm39) nonsense probably null
R8397:Frem2 UTSW 3 53,560,562 (GRCm39) missense probably benign 0.00
R8410:Frem2 UTSW 3 53,446,598 (GRCm39) missense possibly damaging 0.60
R8697:Frem2 UTSW 3 53,433,249 (GRCm39) missense probably damaging 0.99
R9134:Frem2 UTSW 3 53,562,321 (GRCm39) missense probably damaging 1.00
R9183:Frem2 UTSW 3 53,427,486 (GRCm39) missense probably damaging 1.00
R9260:Frem2 UTSW 3 53,560,204 (GRCm39) missense probably damaging 1.00
R9267:Frem2 UTSW 3 53,564,504 (GRCm39) start codon destroyed probably null 0.00
R9299:Frem2 UTSW 3 53,563,980 (GRCm39) missense probably benign 0.37
R9378:Frem2 UTSW 3 53,559,410 (GRCm39) missense probably damaging 0.99
R9444:Frem2 UTSW 3 53,560,265 (GRCm39) missense probably benign 0.10
R9459:Frem2 UTSW 3 53,560,907 (GRCm39) missense probably benign
R9487:Frem2 UTSW 3 53,560,905 (GRCm39) missense possibly damaging 0.95
R9728:Frem2 UTSW 3 53,564,052 (GRCm39) missense probably benign 0.00
R9759:Frem2 UTSW 3 53,562,918 (GRCm39) missense possibly damaging 0.76
Z1177:Frem2 UTSW 3 53,563,028 (GRCm39) missense probably benign 0.31
Z1177:Frem2 UTSW 3 53,442,587 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATCATGGCCACGAAACTGG -3'
(R):5'- TGCTAGGGACCAGTAATGCC -3'

Sequencing Primer
(F):5'- CACGAAACTGGGCTTGGGTG -3'
(R):5'- GACCAGTAATGCCTTGGACGATC -3'
Posted On 2016-04-15