Incidental Mutation 'R4930:Spaca1'
ID 381141
Institutional Source Beutler Lab
Gene Symbol Spaca1
Ensembl Gene ENSMUSG00000028264
Gene Name sperm acrosome associated 1
Synonyms 1700124L11Rik, 4930540L03Rik
MMRRC Submission 042531-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4930 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 34024872-34050067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34044236 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 86 (V86A)
Ref Sequence ENSEMBL: ENSMUSP00000081785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029927] [ENSMUST00000084734] [ENSMUST00000108148]
AlphaFold Q9DA48
Predicted Effect probably benign
Transcript: ENSMUST00000029927
AA Change: V86A

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029927
Gene: ENSMUSG00000028264
AA Change: V86A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084734
AA Change: V86A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081785
Gene: ENSMUSG00000028264
AA Change: V86A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108148
SMART Domains Protein: ENSMUSP00000103783
Gene: ENSMUSG00000028264

DomainStartEndE-ValueType
transmembrane domain 109 131 N/A INTRINSIC
Meta Mutation Damage Score 0.1127 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from infertile males. Furthermore, antibodies generated against the recombinant protein block in vitro fertilization. This protein localizes to the acrosomal membrane of spermatids and mature spermatozoa where it is thought to play a role in acrosomal morphogenesis and in sperm-egg binding and fusion, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice are infertile and display globozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C T 12: 72,953,008 (GRCm39) E242K possibly damaging Het
A930011G23Rik A G 5: 99,370,263 (GRCm39) M499T possibly damaging Het
Abcb8 G A 5: 24,605,779 (GRCm39) V196M possibly damaging Het
Ahnak T C 19: 8,988,331 (GRCm39) M3205T possibly damaging Het
Ankrd1 A G 19: 36,092,433 (GRCm39) Y265H probably damaging Het
Apeh A G 9: 107,965,024 (GRCm39) S446P probably benign Het
Apip C A 2: 102,922,226 (GRCm39) Y197* probably null Het
Arhgef11 T G 3: 87,635,901 (GRCm39) V925G probably damaging Het
Arid4b T C 13: 14,362,062 (GRCm39) V929A probably damaging Het
Asah2 T A 19: 32,030,306 (GRCm39) D122V probably benign Het
B2m A T 2: 121,982,128 (GRCm39) D116V possibly damaging Het
Bhmt-ps1 A G 4: 26,369,184 (GRCm39) noncoding transcript Het
Cacna1g T A 11: 94,334,899 (GRCm39) I803F probably damaging Het
Ccdc43 A T 11: 102,581,111 (GRCm39) V113E probably damaging Het
Cenpj A T 14: 56,772,238 (GRCm39) Y388* probably null Het
Chd3 G A 11: 69,245,034 (GRCm39) probably benign Het
Chil3 C T 3: 106,071,524 (GRCm39) D47N possibly damaging Het
Colgalt2 A G 1: 152,375,710 (GRCm39) T361A possibly damaging Het
Cops3 C A 11: 59,726,193 (GRCm39) probably benign Het
Crb2 G T 2: 37,673,326 (GRCm39) G74V probably damaging Het
Cspg4b G T 13: 113,464,196 (GRCm39) G1453C probably damaging Het
Cyp20a1 A T 1: 60,405,878 (GRCm39) Y224F probably damaging Het
Diaph3 A G 14: 87,378,602 (GRCm39) probably benign Het
Dnah3 A T 7: 119,550,904 (GRCm39) Y3127* probably null Het
Eef1akmt3 A C 10: 126,877,224 (GRCm39) S14A possibly damaging Het
Ehf C A 2: 103,097,202 (GRCm39) R250L probably damaging Het
Eps8l1 G A 7: 4,463,915 (GRCm39) R13Q possibly damaging Het
Frem2 A C 3: 53,563,736 (GRCm39) V257G possibly damaging Het
Gc T C 5: 89,587,448 (GRCm39) T259A probably benign Het
Gm4952 A T 19: 12,604,376 (GRCm39) N263Y probably benign Het
Gpcpd1 T A 2: 132,388,794 (GRCm39) H326L probably damaging Het
Helz T C 11: 107,510,994 (GRCm39) F617L probably damaging Het
Hoxb4 T C 11: 96,209,662 (GRCm39) Y23H probably damaging Het
Hsf4 T A 8: 105,999,330 (GRCm39) probably null Het
Ift56 A T 6: 38,368,475 (GRCm39) Y174F probably damaging Het
Ighv1-81 T C 12: 115,883,924 (GRCm39) D109G probably damaging Het
Irx4 T C 13: 73,417,032 (GRCm39) V476A probably benign Het
Katnb1 T A 8: 95,823,922 (GRCm39) probably null Het
L3mbtl1 A G 2: 162,807,692 (GRCm39) Y490C probably damaging Het
Lemd2 A G 17: 27,412,806 (GRCm39) probably null Het
Lrrc38 A T 4: 143,096,438 (GRCm39) T250S probably damaging Het
Map3k8 A T 18: 4,349,215 (GRCm39) Y34* probably null Het
Mgst1 T A 6: 138,130,507 (GRCm39) F79I probably benign Het
Midn T C 10: 79,991,189 (GRCm39) S357P probably benign Het
Mmp3 T A 9: 7,447,640 (GRCm39) D208E probably benign Het
Mrps26 A G 2: 130,406,862 (GRCm39) E163G probably damaging Het
Mycbpap A T 11: 94,393,983 (GRCm39) M371K probably benign Het
Mynn A C 3: 30,661,191 (GRCm39) N91T probably damaging Het
Nek11 A G 9: 105,177,265 (GRCm39) L292P probably damaging Het
Nid1 A T 13: 13,684,596 (GRCm39) R1228W probably damaging Het
Nphs2 T C 1: 156,148,499 (GRCm39) Y121H probably damaging Het
Or1f19 T G 16: 3,410,299 (GRCm39) L13R probably damaging Het
Or4p7 G A 2: 88,222,284 (GRCm39) R231H probably benign Het
Or5ac22 C A 16: 59,135,236 (GRCm39) C178F probably damaging Het
Or5ap2 T A 2: 85,680,237 (GRCm39) I147N probably benign Het
Or5d38 A C 2: 87,954,684 (GRCm39) I215S probably benign Het
Or7e176 T C 9: 20,171,313 (GRCm39) I59T probably damaging Het
Or9q2 T C 19: 13,772,915 (GRCm39) H20R probably benign Het
P2rx7 C T 5: 122,808,542 (GRCm39) T308M probably damaging Het
Prdx6 C T 1: 161,069,263 (GRCm39) probably benign Het
Rad54b T A 4: 11,615,579 (GRCm39) D862E probably damaging Het
Ripor1 A G 8: 106,343,814 (GRCm39) Y344C probably damaging Het
Rnf112 T C 11: 61,344,291 (GRCm39) M43V probably benign Het
Rp1l1 A G 14: 64,269,655 (GRCm39) N1747S probably benign Het
Rps27 A G 3: 90,120,306 (GRCm39) V22A probably damaging Het
Spdef A G 17: 27,937,136 (GRCm39) Y156H probably damaging Het
Specc1 A C 11: 62,009,784 (GRCm39) E433D possibly damaging Het
Srpra T A 9: 35,126,326 (GRCm39) F506L probably benign Het
Stxbp5 A G 10: 9,636,610 (GRCm39) probably benign Het
Syne1 C T 10: 5,002,777 (GRCm39) R8046Q probably damaging Het
Tbx5 T A 5: 120,021,090 (GRCm39) S365R probably benign Het
Terb1 G T 8: 105,174,580 (GRCm39) P698Q probably benign Het
Tmbim7 T A 5: 3,711,948 (GRCm39) Y27* probably null Het
Tmem106c C A 15: 97,862,909 (GRCm39) A60E possibly damaging Het
Ttc6 T A 12: 57,720,609 (GRCm39) probably null Het
Ttn T C 2: 76,562,714 (GRCm39) I28747V possibly damaging Het
Unc13a C T 8: 72,083,148 (GRCm39) probably null Het
Wdr81 T C 11: 75,342,750 (GRCm39) D839G probably benign Het
Wfdc15a G C 2: 164,041,725 (GRCm39) Q33E probably benign Het
Zfp456 T C 13: 67,515,065 (GRCm39) R214G probably benign Het
Zfp457 T A 13: 67,442,164 (GRCm39) Y137F probably damaging Het
Other mutations in Spaca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Spaca1 APN 4 34,029,077 (GRCm39) missense probably damaging 0.99
IGL01871:Spaca1 APN 4 34,040,894 (GRCm39) missense probably damaging 0.98
F5770:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
FR4342:Spaca1 UTSW 4 34,049,838 (GRCm39) small insertion probably benign
FR4548:Spaca1 UTSW 4 34,049,856 (GRCm39) small insertion probably benign
FR4737:Spaca1 UTSW 4 34,049,836 (GRCm39) small insertion probably benign
FR4976:Spaca1 UTSW 4 34,049,849 (GRCm39) small insertion probably benign
FR4976:Spaca1 UTSW 4 34,049,844 (GRCm39) small insertion probably benign
R0377:Spaca1 UTSW 4 34,044,267 (GRCm39) splice site probably null
R1861:Spaca1 UTSW 4 34,044,206 (GRCm39) missense probably damaging 0.99
R3105:Spaca1 UTSW 4 34,028,468 (GRCm39) missense probably damaging 1.00
R5030:Spaca1 UTSW 4 34,039,247 (GRCm39) missense possibly damaging 0.65
R5137:Spaca1 UTSW 4 34,029,095 (GRCm39) missense probably damaging 1.00
R5264:Spaca1 UTSW 4 34,049,863 (GRCm39) missense possibly damaging 0.53
R6158:Spaca1 UTSW 4 34,029,176 (GRCm39) missense probably damaging 0.99
R6824:Spaca1 UTSW 4 34,049,869 (GRCm39) missense probably benign 0.00
R8039:Spaca1 UTSW 4 34,044,207 (GRCm39) missense probably damaging 0.99
R8094:Spaca1 UTSW 4 34,049,837 (GRCm39) missense possibly damaging 0.55
R8134:Spaca1 UTSW 4 34,042,157 (GRCm39) splice site probably null
R9120:Spaca1 UTSW 4 34,029,168 (GRCm39) missense probably damaging 0.97
RF006:Spaca1 UTSW 4 34,049,853 (GRCm39) small insertion probably benign
RF017:Spaca1 UTSW 4 34,049,853 (GRCm39) small insertion probably benign
RF032:Spaca1 UTSW 4 34,049,854 (GRCm39) small insertion probably benign
RF043:Spaca1 UTSW 4 34,049,846 (GRCm39) small insertion probably benign
RF044:Spaca1 UTSW 4 34,049,854 (GRCm39) small insertion probably benign
RF044:Spaca1 UTSW 4 34,049,846 (GRCm39) small insertion probably benign
RF060:Spaca1 UTSW 4 34,049,841 (GRCm39) small insertion probably benign
V7580:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
V7581:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
V7582:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
V7583:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGAATGCATCTGCTAGATCCAC -3'
(R):5'- GAGTGCTCTTAAAGGTTTAGGATTC -3'

Sequencing Primer
(F):5'- TGCATCTGCTAGATCCACTGAAG -3'
(R):5'- CCATAGGACAATTACTCGACC -3'
Posted On 2016-04-15