Mutagenetix > Incidental Mutation

Incidental Mutation 'R4930:Spaca1'

381141

Institutional Source

Beutler Lab

Gene Symbol

Spaca1

Ensembl Gene

ENSMUSG00000028264

Gene Name

sperm acrosome associated 1

Synonyms

1700124L11Rik, 4930540L03Rik

MMRRC Submission

042531-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4930 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34024874-34050191 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34044236 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 86 (V86A)

Ref Sequence

ENSEMBL: ENSMUSP00000081785 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029927] [ENSMUST00000084734] [ENSMUST00000108148]

AlphaFold

Q9DA48

Predicted Effect

probably benign
Transcript: ENSMUST00000029927
AA Change: V86A

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029927
Gene: ENSMUSG00000028264
AA Change: V86A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
low complexity region	46	79	N/A	INTRINSIC
transmembrane domain	228	250	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084734
AA Change: V86A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000081785
Gene: ENSMUSG00000028264
AA Change: V86A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
low complexity region	46	79	N/A	INTRINSIC
transmembrane domain	228	250	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108148

SMART Domains

Protein: ENSMUSP00000103783
Gene: ENSMUSG00000028264

Domain	Start	End	E-Value	Type
transmembrane domain	109	131	N/A	INTRINSIC

Meta Mutation Damage Score

0.1127

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.1%

Validation Efficiency

99% (88/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from infertile males. Furthermore, antibodies generated against the recombinant protein block in vitro fertilization. This protein localizes to the acrosomal membrane of spermatids and mature spermatozoa where it is thought to play a role in acrosomal morphogenesis and in sperm-egg binding and fusion, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice are infertile and display globozoospermia and asthenozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	C	T	12: 72,906,234	E242K	possibly damaging	Het
A930011G23Rik	A	G	5: 99,222,404	M499T	possibly damaging	Het
Abcb8	G	A	5: 24,400,781	V196M	possibly damaging	Het
Ahnak	T	C	19: 9,010,967	M3205T	possibly damaging	Het
Ankrd1	A	G	19: 36,115,033	Y265H	probably damaging	Het
Apeh	A	G	9: 108,087,825	S446P	probably benign	Het
Apip	C	A	2: 103,091,881	Y197*	probably null	Het
Arhgef11	T	G	3: 87,728,594	V925G	probably damaging	Het
Arid4b	T	C	13: 14,187,477	V929A	probably damaging	Het
Asah2	T	A	19: 32,052,906	D122V	probably benign	Het
B2m	A	T	2: 122,151,647	D116V	possibly damaging	Het
BC067074	G	T	13: 113,327,662	G1453C	probably damaging	Het
Bhmt-ps1	A	G	4: 26,369,184		noncoding transcript	Het
Cacna1g	T	A	11: 94,444,073	I803F	probably damaging	Het
Ccdc43	A	T	11: 102,690,285	V113E	probably damaging	Het
Cenpj	A	T	14: 56,534,781	Y388*	probably null	Het
Chd3	G	A	11: 69,354,208		probably benign	Het
Chil3	C	T	3: 106,164,208	D47N	possibly damaging	Het
Colgalt2	A	G	1: 152,499,959	T361A	possibly damaging	Het
Cops3	C	A	11: 59,835,367		probably benign	Het
Crb2	G	T	2: 37,783,314	G74V	probably damaging	Het
Cyp20a1	A	T	1: 60,366,719	Y224F	probably damaging	Het
Diaph3	A	G	14: 87,141,166		probably benign	Het
Dnah3	A	T	7: 119,951,681	Y3127*	probably null	Het
Eef1akmt3	A	C	10: 127,041,355	S14A	possibly damaging	Het
Ehf	C	A	2: 103,266,857	R250L	probably damaging	Het
Eps8l1	G	A	7: 4,460,916	R13Q	possibly damaging	Het
Frem2	A	C	3: 53,656,315	V257G	possibly damaging	Het
Gc	T	C	5: 89,439,589	T259A	probably benign	Het
Gm4952	A	T	19: 12,627,012	N263Y	probably benign	Het
Gpcpd1	T	A	2: 132,546,874	H326L	probably damaging	Het
Helz	T	C	11: 107,620,168	F617L	probably damaging	Het
Hoxb4	T	C	11: 96,318,836	Y23H	probably damaging	Het
Hsf4	T	A	8: 105,272,698		probably null	Het
Ighv1-81	T	C	12: 115,920,304	D109G	probably damaging	Het
Irx4	T	C	13: 73,268,913	V476A	probably benign	Het
Katnb1	T	A	8: 95,097,294		probably null	Het
L3mbtl1	A	G	2: 162,965,772	Y490C	probably damaging	Het
Lemd2	A	G	17: 27,193,832		probably null	Het
Lrrc38	A	T	4: 143,369,868	T250S	probably damaging	Het
Map3k8	A	T	18: 4,349,215	Y34*	probably null	Het
Mgst1	T	A	6: 138,153,509	F79I	probably benign	Het
Midn	T	C	10: 80,155,355	S357P	probably benign	Het
Mmp3	T	A	9: 7,447,640	D208E	probably benign	Het
Mrps26	A	G	2: 130,564,942	E163G	probably damaging	Het
Mycbpap	A	T	11: 94,503,157	M371K	probably benign	Het
Mynn	A	C	3: 30,607,042	N91T	probably damaging	Het
Nek11	A	G	9: 105,300,066	L292P	probably damaging	Het
Nid1	A	T	13: 13,510,011	R1228W	probably damaging	Het
Nphs2	T	C	1: 156,320,929	Y121H	probably damaging	Het
Olfr1020	T	A	2: 85,849,893	I147N	probably benign	Het
Olfr1166	A	C	2: 88,124,340	I215S	probably benign	Het
Olfr1178	G	A	2: 88,391,940	R231H	probably benign	Het
Olfr1497	T	C	19: 13,795,551	H20R	probably benign	Het
Olfr161	T	G	16: 3,592,435	L13R	probably damaging	Het
Olfr204	C	A	16: 59,314,873	C178F	probably damaging	Het
Olfr872	T	C	9: 20,260,017	I59T	probably damaging	Het
P2rx7	C	T	5: 122,670,479	T308M	probably damaging	Het
Prdx6	C	T	1: 161,241,693		probably benign	Het
Rad54b	T	A	4: 11,615,579	D862E	probably damaging	Het
Ripor1	A	G	8: 105,617,182	Y344C	probably damaging	Het
Rnf112	T	C	11: 61,453,465	M43V	probably benign	Het
Rp1l1	A	G	14: 64,032,206	N1747S	probably benign	Het
Rps27	A	G	3: 90,212,999	V22A	probably damaging	Het
Spdef	A	G	17: 27,718,162	Y156H	probably damaging	Het
Specc1	A	C	11: 62,118,958	E433D	possibly damaging	Het
Srpr	T	A	9: 35,215,030	F506L	probably benign	Het
Stxbp5	A	G	10: 9,760,866		probably benign	Het
Syne1	C	T	10: 5,052,777	R8046Q	probably damaging	Het
Tbx5	T	A	5: 119,883,025	S365R	probably benign	Het
Terb1	G	T	8: 104,447,948	P698Q	probably benign	Het
Tmbim7	T	A	5: 3,661,948	Y27*	probably null	Het
Tmem106c	C	A	15: 97,965,028	A60E	possibly damaging	Het
Ttc26	A	T	6: 38,391,540	Y174F	probably damaging	Het
Ttc6	T	A	12: 57,673,823		probably null	Het
Ttn	T	C	2: 76,732,370	I28747V	possibly damaging	Het
Unc13a	C	T	8: 71,630,504		probably null	Het
Wdr81	T	C	11: 75,451,924	D839G	probably benign	Het
Wfdc15a	G	C	2: 164,199,805	Q33E	probably benign	Het
Zfp456	T	C	13: 67,366,946	R214G	probably benign	Het
Zfp457	T	A	13: 67,294,100	Y137F	probably damaging	Het

Other mutations in Spaca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00505:Spaca1	APN	4	34029077	missense	probably damaging	0.99
IGL01871:Spaca1	APN	4	34040894	missense	probably damaging	0.98
F5770:Spaca1	UTSW	4	34039311	missense	probably damaging	0.99
FR4342:Spaca1	UTSW	4	34049838	small insertion	probably benign
FR4548:Spaca1	UTSW	4	34049856	small insertion	probably benign
FR4737:Spaca1	UTSW	4	34049836	small insertion	probably benign
FR4976:Spaca1	UTSW	4	34049844	small insertion	probably benign
FR4976:Spaca1	UTSW	4	34049849	small insertion	probably benign
R0377:Spaca1	UTSW	4	34044267	splice site	probably null
R1861:Spaca1	UTSW	4	34044206	missense	probably damaging	0.99
R3105:Spaca1	UTSW	4	34028468	missense	probably damaging	1.00
R5030:Spaca1	UTSW	4	34039247	missense	possibly damaging	0.65
R5137:Spaca1	UTSW	4	34029095	missense	probably damaging	1.00
R5264:Spaca1	UTSW	4	34049863	missense	possibly damaging	0.53
R6158:Spaca1	UTSW	4	34029176	missense	probably damaging	0.99
R6824:Spaca1	UTSW	4	34049869	missense	probably benign	0.00
R8039:Spaca1	UTSW	4	34044207	missense	probably damaging	0.99
R8094:Spaca1	UTSW	4	34049837	missense	possibly damaging	0.55
R8134:Spaca1	UTSW	4	34042157	splice site	probably null
R9120:Spaca1	UTSW	4	34029168	missense	probably damaging	0.97
RF006:Spaca1	UTSW	4	34049853	small insertion	probably benign
RF017:Spaca1	UTSW	4	34049853	small insertion	probably benign
RF032:Spaca1	UTSW	4	34049854	small insertion	probably benign
RF043:Spaca1	UTSW	4	34049846	small insertion	probably benign
RF044:Spaca1	UTSW	4	34049846	small insertion	probably benign
RF044:Spaca1	UTSW	4	34049854	small insertion	probably benign
RF060:Spaca1	UTSW	4	34049841	small insertion	probably benign
V7580:Spaca1	UTSW	4	34039311	missense	probably damaging	0.99
V7581:Spaca1	UTSW	4	34039311	missense	probably damaging	0.99
V7582:Spaca1	UTSW	4	34039311	missense	probably damaging	0.99
V7583:Spaca1	UTSW	4	34039311	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGAATGCATCTGCTAGATCCAC -3'
(R):5'- GAGTGCTCTTAAAGGTTTAGGATTC -3'

Sequencing Primer
(F):5'- TGCATCTGCTAGATCCACTGAAG -3'
(R):5'- CCATAGGACAATTACTCGACC -3'

Posted On

2016-04-15