Incidental Mutation 'R4930:Terb1'
ID381157
Institutional Source Beutler Lab
Gene Symbol Terb1
Ensembl Gene ENSMUSG00000052616
Gene Nametelomere repeat binding bouquet formation protein 1
SynonymsCcdc79, 4930532D21Rik
MMRRC Submission 042531-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4930 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104446719-104509910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 104447948 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 698 (P698Q)
Ref Sequence ENSEMBL: ENSMUSP00000067324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041769] [ENSMUST00000064576] [ENSMUST00000159713] [ENSMUST00000161520]
PDB Structure
Solution structures of the myb-like DNA binding domain of 4930532D21Rik protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000041769
SMART Domains Protein: ENSMUSP00000045480
Gene: ENSMUSG00000035770

DomainStartEndE-ValueType
Pfam:DLIC 30 491 5.8e-264 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064576
AA Change: P698Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067324
Gene: ENSMUSG00000052616
AA Change: P698Q

DomainStartEndE-ValueType
SCOP:d1ee4a_ 2 368 7e-11 SMART
low complexity region 416 428 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
SANT 711 762 7.07e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159713
SMART Domains Protein: ENSMUSP00000124706
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 335 6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161520
SMART Domains Protein: ENSMUSP00000125431
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 336 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162014
SMART Domains Protein: ENSMUSP00000123925
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1jdha_ 21 370 7e-8 SMART
low complexity region 382 394 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
low complexity region 688 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212040
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 99% (88/89)
MGI Phenotype PHENOTYPE: Male and female mice homozygous for a null allele are infertile with arrest of meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C T 12: 72,906,234 E242K possibly damaging Het
A930011G23Rik A G 5: 99,222,404 M499T possibly damaging Het
Abcb8 G A 5: 24,400,781 V196M possibly damaging Het
Ahnak T C 19: 9,010,967 M3205T possibly damaging Het
Ankrd1 A G 19: 36,115,033 Y265H probably damaging Het
Apeh A G 9: 108,087,825 S446P probably benign Het
Apip C A 2: 103,091,881 Y197* probably null Het
Arhgef11 T G 3: 87,728,594 V925G probably damaging Het
Arid4b T C 13: 14,187,477 V929A probably damaging Het
Asah2 T A 19: 32,052,906 D122V probably benign Het
B2m A T 2: 122,151,647 D116V possibly damaging Het
BC067074 G T 13: 113,327,662 G1453C probably damaging Het
Bhmt-ps1 A G 4: 26,369,184 noncoding transcript Het
Cacna1g T A 11: 94,444,073 I803F probably damaging Het
Ccdc43 A T 11: 102,690,285 V113E probably damaging Het
Cenpj A T 14: 56,534,781 Y388* probably null Het
Chd3 G A 11: 69,354,208 probably benign Het
Chil3 C T 3: 106,164,208 D47N possibly damaging Het
Colgalt2 A G 1: 152,499,959 T361A possibly damaging Het
Cops3 C A 11: 59,835,367 probably benign Het
Crb2 G T 2: 37,783,314 G74V probably damaging Het
Cyp20a1 A T 1: 60,366,719 Y224F probably damaging Het
Diaph3 A G 14: 87,141,166 probably benign Het
Dnah3 A T 7: 119,951,681 Y3127* probably null Het
Eef1akmt3 A C 10: 127,041,355 S14A possibly damaging Het
Ehf C A 2: 103,266,857 R250L probably damaging Het
Eps8l1 G A 7: 4,460,916 R13Q possibly damaging Het
Frem2 A C 3: 53,656,315 V257G possibly damaging Het
Gc T C 5: 89,439,589 T259A probably benign Het
Gm4952 A T 19: 12,627,012 N263Y probably benign Het
Gpcpd1 T A 2: 132,546,874 H326L probably damaging Het
Helz T C 11: 107,620,168 F617L probably damaging Het
Hoxb4 T C 11: 96,318,836 Y23H probably damaging Het
Hsf4 T A 8: 105,272,698 probably null Het
Ighv1-81 T C 12: 115,920,304 D109G probably damaging Het
Irx4 T C 13: 73,268,913 V476A probably benign Het
Katnb1 T A 8: 95,097,294 probably null Het
L3mbtl1 A G 2: 162,965,772 Y490C probably damaging Het
Lemd2 A G 17: 27,193,832 probably null Het
Lrrc38 A T 4: 143,369,868 T250S probably damaging Het
Map3k8 A T 18: 4,349,215 Y34* probably null Het
Mgst1 T A 6: 138,153,509 F79I probably benign Het
Midn T C 10: 80,155,355 S357P probably benign Het
Mmp3 T A 9: 7,447,640 D208E probably benign Het
Mrps26 A G 2: 130,564,942 E163G probably damaging Het
Mycbpap A T 11: 94,503,157 M371K probably benign Het
Mynn A C 3: 30,607,042 N91T probably damaging Het
Nek11 A G 9: 105,300,066 L292P probably damaging Het
Nid1 A T 13: 13,510,011 R1228W probably damaging Het
Nphs2 T C 1: 156,320,929 Y121H probably damaging Het
Olfr1020 T A 2: 85,849,893 I147N probably benign Het
Olfr1166 A C 2: 88,124,340 I215S probably benign Het
Olfr1178 G A 2: 88,391,940 R231H probably benign Het
Olfr1497 T C 19: 13,795,551 H20R probably benign Het
Olfr161 T G 16: 3,592,435 L13R probably damaging Het
Olfr204 C A 16: 59,314,873 C178F probably damaging Het
Olfr872 T C 9: 20,260,017 I59T probably damaging Het
P2rx7 C T 5: 122,670,479 T308M probably damaging Het
Prdx6 C T 1: 161,241,693 probably benign Het
Rad54b T A 4: 11,615,579 D862E probably damaging Het
Ripor1 A G 8: 105,617,182 Y344C probably damaging Het
Rnf112 T C 11: 61,453,465 M43V probably benign Het
Rp1l1 A G 14: 64,032,206 N1747S probably benign Het
Rps27 A G 3: 90,212,999 V22A probably damaging Het
Spaca1 A G 4: 34,044,236 V86A possibly damaging Het
Spdef A G 17: 27,718,162 Y156H probably damaging Het
Specc1 A C 11: 62,118,958 E433D possibly damaging Het
Srpr T A 9: 35,215,030 F506L probably benign Het
Stxbp5 A G 10: 9,760,866 probably benign Het
Syne1 C T 10: 5,052,777 R8046Q probably damaging Het
Tbx5 T A 5: 119,883,025 S365R probably benign Het
Tmbim7 T A 5: 3,661,948 Y27* probably null Het
Tmem106c C A 15: 97,965,028 A60E possibly damaging Het
Ttc26 A T 6: 38,391,540 Y174F probably damaging Het
Ttc6 T A 12: 57,673,823 probably null Het
Ttn T C 2: 76,732,370 I28747V possibly damaging Het
Unc13a C T 8: 71,630,504 probably null Het
Wdr81 T C 11: 75,451,924 D839G probably benign Het
Wfdc15a G C 2: 164,199,805 Q33E probably benign Het
Zfp456 T C 13: 67,366,946 R214G probably benign Het
Zfp457 T A 13: 67,294,100 Y137F probably damaging Het
Other mutations in Terb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Terb1 APN 8 104451807 missense probably benign 0.09
IGL01468:Terb1 APN 8 104482167 intron probably benign
IGL01619:Terb1 APN 8 104473014 missense probably benign 0.00
IGL01631:Terb1 APN 8 104472864 missense probably damaging 0.99
IGL02041:Terb1 APN 8 104495114 missense probably damaging 1.00
IGL02413:Terb1 APN 8 104494868 critical splice donor site probably null
IGL02974:Terb1 APN 8 104494968 nonsense probably null
IGL03091:Terb1 APN 8 104469154 missense probably benign 0.03
IGL03410:Terb1 APN 8 104473042 splice site probably benign
R0825:Terb1 UTSW 8 104468748 missense possibly damaging 0.65
R0906:Terb1 UTSW 8 104452636 missense probably damaging 1.00
R1175:Terb1 UTSW 8 104484306 missense probably benign 0.07
R1494:Terb1 UTSW 8 104498490 splice site probably benign
R1657:Terb1 UTSW 8 104488491 missense possibly damaging 0.77
R2018:Terb1 UTSW 8 104452699 missense probably benign 0.00
R2029:Terb1 UTSW 8 104498100 splice site probably benign
R2047:Terb1 UTSW 8 104485462 missense probably damaging 1.00
R2062:Terb1 UTSW 8 104468748 missense possibly damaging 0.65
R2179:Terb1 UTSW 8 104452715 missense probably damaging 0.99
R2179:Terb1 UTSW 8 104472737 missense probably benign 0.08
R2187:Terb1 UTSW 8 104472884 missense probably benign
R2420:Terb1 UTSW 8 104498595 missense probably damaging 1.00
R2867:Terb1 UTSW 8 104447853 unclassified probably benign
R3749:Terb1 UTSW 8 104496834 missense probably damaging 1.00
R4850:Terb1 UTSW 8 104485425 missense probably benign 0.02
R4963:Terb1 UTSW 8 104482318 missense probably damaging 1.00
R4969:Terb1 UTSW 8 104495163 missense probably benign 0.00
R5100:Terb1 UTSW 8 104495173 nonsense probably null
R5440:Terb1 UTSW 8 104488499 missense probably damaging 1.00
R5824:Terb1 UTSW 8 104485447 missense probably benign 0.08
R5950:Terb1 UTSW 8 104488485 critical splice donor site probably null
R5985:Terb1 UTSW 8 104451807 missense probably benign 0.09
R5985:Terb1 UTSW 8 104482316 missense probably damaging 1.00
R6320:Terb1 UTSW 8 104447199 missense probably damaging 1.00
R6432:Terb1 UTSW 8 104485446 missense possibly damaging 0.65
R6473:Terb1 UTSW 8 104473037 missense probably damaging 1.00
R6701:Terb1 UTSW 8 104472756 missense possibly damaging 0.69
R7013:Terb1 UTSW 8 104488590 nonsense probably null
R7064:Terb1 UTSW 8 104488554 missense probably benign 0.00
R7237:Terb1 UTSW 8 104495327 missense possibly damaging 0.85
R7361:Terb1 UTSW 8 104468799 missense probably damaging 1.00
R7549:Terb1 UTSW 8 104498084 missense possibly damaging 0.85
R7915:Terb1 UTSW 8 104447216 missense possibly damaging 0.59
R8112:Terb1 UTSW 8 104468767 missense probably benign 0.32
R8256:Terb1 UTSW 8 104472947 missense possibly damaging 0.92
R8329:Terb1 UTSW 8 104484371 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTCCATAACTTCACAGAG -3'
(R):5'- GGAGTGTGTCCATATGTATCGC -3'

Sequencing Primer
(F):5'- TCACAGAGAAGAATACCAACATTTG -3'
(R):5'- GTGTGTCCATATGTATCGCATATAC -3'
Posted On2016-04-15