Incidental Mutation 'R4930:Helz'
ID381178
Institutional Source Beutler Lab
Gene Symbol Helz
Ensembl Gene ENSMUSG00000020721
Gene Namehelicase with zinc finger domain
Synonyms9630002H22Rik, 3110078M01Rik, 9430093I07Rik
MMRRC Submission 042531-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4930 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location107547930-107693826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107620168 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 617 (F617L)
Ref Sequence ENSEMBL: ENSMUSP00000102357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075012] [ENSMUST00000100305] [ENSMUST00000106746]
Predicted Effect probably damaging
Transcript: ENSMUST00000075012
AA Change: F617L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074533
Gene: ENSMUSG00000020721
AA Change: F617L

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:ResIII 639 807 6.7e-8 PFAM
Pfam:AAA_11 641 768 2.3e-14 PFAM
Pfam:AAA_30 641 838 2.6e-11 PFAM
Pfam:AAA_19 648 729 5.5e-11 PFAM
Pfam:AAA_11 758 834 3.8e-18 PFAM
Pfam:AAA_12 841 1053 7.4e-38 PFAM
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1360 1448 N/A INTRINSIC
low complexity region 1466 1487 N/A INTRINSIC
low complexity region 1557 1568 N/A INTRINSIC
low complexity region 1631 1647 N/A INTRINSIC
low complexity region 1716 1736 N/A INTRINSIC
low complexity region 1926 1933 N/A INTRINSIC
low complexity region 1942 1957 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100305
AA Change: F617L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097878
Gene: ENSMUSG00000020721
AA Change: F617L

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 2.7e-31 PFAM
Pfam:AAA_30 641 837 1.7e-10 PFAM
Pfam:AAA_19 648 727 6.3e-9 PFAM
Pfam:AAA_12 840 1052 3.4e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106746
AA Change: F617L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102357
Gene: ENSMUSG00000020721
AA Change: F617L

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 1e-31 PFAM
Pfam:AAA_30 641 837 8.3e-11 PFAM
Pfam:AAA_19 648 727 2.2e-9 PFAM
Pfam:AAA_12 840 1052 1.7e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
low complexity region 1630 1646 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1925 1932 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Meta Mutation Damage Score 0.4846 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable, fertile and phenotypically normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C T 12: 72,906,234 E242K possibly damaging Het
A930011G23Rik A G 5: 99,222,404 M499T possibly damaging Het
Abcb8 G A 5: 24,400,781 V196M possibly damaging Het
Ahnak T C 19: 9,010,967 M3205T possibly damaging Het
Ankrd1 A G 19: 36,115,033 Y265H probably damaging Het
Apeh A G 9: 108,087,825 S446P probably benign Het
Apip C A 2: 103,091,881 Y197* probably null Het
Arhgef11 T G 3: 87,728,594 V925G probably damaging Het
Arid4b T C 13: 14,187,477 V929A probably damaging Het
Asah2 T A 19: 32,052,906 D122V probably benign Het
B2m A T 2: 122,151,647 D116V possibly damaging Het
BC067074 G T 13: 113,327,662 G1453C probably damaging Het
Bhmt-ps1 A G 4: 26,369,184 noncoding transcript Het
Cacna1g T A 11: 94,444,073 I803F probably damaging Het
Ccdc43 A T 11: 102,690,285 V113E probably damaging Het
Cenpj A T 14: 56,534,781 Y388* probably null Het
Chd3 G A 11: 69,354,208 probably benign Het
Chil3 C T 3: 106,164,208 D47N possibly damaging Het
Colgalt2 A G 1: 152,499,959 T361A possibly damaging Het
Cops3 C A 11: 59,835,367 probably benign Het
Crb2 G T 2: 37,783,314 G74V probably damaging Het
Cyp20a1 A T 1: 60,366,719 Y224F probably damaging Het
Diaph3 A G 14: 87,141,166 probably benign Het
Dnah3 A T 7: 119,951,681 Y3127* probably null Het
Eef1akmt3 A C 10: 127,041,355 S14A possibly damaging Het
Ehf C A 2: 103,266,857 R250L probably damaging Het
Eps8l1 G A 7: 4,460,916 R13Q possibly damaging Het
Frem2 A C 3: 53,656,315 V257G possibly damaging Het
Gc T C 5: 89,439,589 T259A probably benign Het
Gm4952 A T 19: 12,627,012 N263Y probably benign Het
Gpcpd1 T A 2: 132,546,874 H326L probably damaging Het
Hoxb4 T C 11: 96,318,836 Y23H probably damaging Het
Hsf4 T A 8: 105,272,698 probably null Het
Ighv1-81 T C 12: 115,920,304 D109G probably damaging Het
Irx4 T C 13: 73,268,913 V476A probably benign Het
Katnb1 T A 8: 95,097,294 probably null Het
L3mbtl1 A G 2: 162,965,772 Y490C probably damaging Het
Lemd2 A G 17: 27,193,832 probably null Het
Lrrc38 A T 4: 143,369,868 T250S probably damaging Het
Map3k8 A T 18: 4,349,215 Y34* probably null Het
Mgst1 T A 6: 138,153,509 F79I probably benign Het
Midn T C 10: 80,155,355 S357P probably benign Het
Mmp3 T A 9: 7,447,640 D208E probably benign Het
Mrps26 A G 2: 130,564,942 E163G probably damaging Het
Mycbpap A T 11: 94,503,157 M371K probably benign Het
Mynn A C 3: 30,607,042 N91T probably damaging Het
Nek11 A G 9: 105,300,066 L292P probably damaging Het
Nid1 A T 13: 13,510,011 R1228W probably damaging Het
Nphs2 T C 1: 156,320,929 Y121H probably damaging Het
Olfr1020 T A 2: 85,849,893 I147N probably benign Het
Olfr1166 A C 2: 88,124,340 I215S probably benign Het
Olfr1178 G A 2: 88,391,940 R231H probably benign Het
Olfr1497 T C 19: 13,795,551 H20R probably benign Het
Olfr161 T G 16: 3,592,435 L13R probably damaging Het
Olfr204 C A 16: 59,314,873 C178F probably damaging Het
Olfr872 T C 9: 20,260,017 I59T probably damaging Het
P2rx7 C T 5: 122,670,479 T308M probably damaging Het
Prdx6 C T 1: 161,241,693 probably benign Het
Rad54b T A 4: 11,615,579 D862E probably damaging Het
Ripor1 A G 8: 105,617,182 Y344C probably damaging Het
Rnf112 T C 11: 61,453,465 M43V probably benign Het
Rp1l1 A G 14: 64,032,206 N1747S probably benign Het
Rps27 A G 3: 90,212,999 V22A probably damaging Het
Spaca1 A G 4: 34,044,236 V86A possibly damaging Het
Spdef A G 17: 27,718,162 Y156H probably damaging Het
Specc1 A C 11: 62,118,958 E433D possibly damaging Het
Srpr T A 9: 35,215,030 F506L probably benign Het
Stxbp5 A G 10: 9,760,866 probably benign Het
Syne1 C T 10: 5,052,777 R8046Q probably damaging Het
Tbx5 T A 5: 119,883,025 S365R probably benign Het
Terb1 G T 8: 104,447,948 P698Q probably benign Het
Tmbim7 T A 5: 3,661,948 Y27* probably null Het
Tmem106c C A 15: 97,965,028 A60E possibly damaging Het
Ttc26 A T 6: 38,391,540 Y174F probably damaging Het
Ttc6 T A 12: 57,673,823 probably null Het
Ttn T C 2: 76,732,370 I28747V possibly damaging Het
Unc13a C T 8: 71,630,504 probably null Het
Wdr81 T C 11: 75,451,924 D839G probably benign Het
Wfdc15a G C 2: 164,199,805 Q33E probably benign Het
Zfp456 T C 13: 67,366,946 R214G probably benign Het
Zfp457 T A 13: 67,294,100 Y137F probably damaging Het
Other mutations in Helz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Helz APN 11 107663653 missense possibly damaging 0.90
IGL01419:Helz APN 11 107686514 missense unknown
IGL01864:Helz APN 11 107602354 missense probably damaging 0.98
IGL01999:Helz APN 11 107602928 splice site probably benign
IGL02938:Helz APN 11 107686438 missense unknown
IGL03157:Helz APN 11 107577888 missense possibly damaging 0.95
IGL03374:Helz APN 11 107620147 missense probably damaging 0.98
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0112:Helz UTSW 11 107672948 unclassified probably benign
R0243:Helz UTSW 11 107637914 missense possibly damaging 0.85
R0328:Helz UTSW 11 107604348 missense probably benign 0.30
R0578:Helz UTSW 11 107686400 missense unknown
R0928:Helz UTSW 11 107626693 missense probably damaging 0.99
R1428:Helz UTSW 11 107592840 splice site probably benign
R1493:Helz UTSW 11 107613925 missense probably benign 0.15
R1494:Helz UTSW 11 107604063 splice site probably benign
R1541:Helz UTSW 11 107670048 missense probably benign 0.39
R1619:Helz UTSW 11 107636279 nonsense probably null
R1809:Helz UTSW 11 107599171 missense possibly damaging 0.87
R1942:Helz UTSW 11 107602492 missense probably benign 0.20
R2095:Helz UTSW 11 107646146 missense probably damaging 1.00
R2133:Helz UTSW 11 107670484 missense unknown
R2167:Helz UTSW 11 107672964 unclassified probably benign
R2406:Helz UTSW 11 107686552 missense unknown
R2571:Helz UTSW 11 107613952 missense probably benign 0.05
R2858:Helz UTSW 11 107672927 unclassified probably benign
R3927:Helz UTSW 11 107685292 missense unknown
R4449:Helz UTSW 11 107604163 missense probably benign 0.01
R4453:Helz UTSW 11 107672629 nonsense probably null
R4583:Helz UTSW 11 107646069 missense probably damaging 1.00
R4684:Helz UTSW 11 107649145 missense probably damaging 1.00
R4714:Helz UTSW 11 107626716 critical splice donor site probably null
R4875:Helz UTSW 11 107637734 intron probably benign
R4924:Helz UTSW 11 107602339 missense probably damaging 1.00
R5078:Helz UTSW 11 107656096 missense probably damaging 1.00
R5446:Helz UTSW 11 107632204 missense probably damaging 1.00
R5535:Helz UTSW 11 107646120 missense probably damaging 0.98
R5650:Helz UTSW 11 107595146 missense probably null 0.96
R5714:Helz UTSW 11 107626521 splice site probably null
R5784:Helz UTSW 11 107670481 missense unknown
R5998:Helz UTSW 11 107685534 nonsense probably null
R6042:Helz UTSW 11 107614120 critical splice donor site probably null
R6089:Helz UTSW 11 107595137 critical splice acceptor site probably null
R6137:Helz UTSW 11 107619060 missense possibly damaging 0.83
R6373:Helz UTSW 11 107595184 missense probably benign 0.01
R6392:Helz UTSW 11 107602341 missense possibly damaging 0.80
R6618:Helz UTSW 11 107599150 missense probably benign 0.01
R6644:Helz UTSW 11 107632261 missense possibly damaging 0.74
R6811:Helz UTSW 11 107619318 critical splice donor site probably null
R6874:Helz UTSW 11 107663634 missense probably damaging 0.97
R6911:Helz UTSW 11 107619225 missense probably benign 0.01
R7039:Helz UTSW 11 107619318 critical splice donor site probably null
R7061:Helz UTSW 11 107649177 missense possibly damaging 0.83
R7438:Helz UTSW 11 107662030 missense probably damaging 0.98
R7464:Helz UTSW 11 107636278 missense probably damaging 1.00
R7513:Helz UTSW 11 107656115 missense probably damaging 0.99
R7559:Helz UTSW 11 107600278 missense possibly damaging 0.67
R7734:Helz UTSW 11 107685422 missense unknown
R7780:Helz UTSW 11 107637863 missense probably damaging 1.00
R8024:Helz UTSW 11 107686421 missense unknown
X0065:Helz UTSW 11 107670447 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTGCAGAAGGTTGTCTCCATG -3'
(R):5'- CATAGGCTTGAGCTCAGGATAC -3'

Sequencing Primer
(F):5'- CCATGAAGTATTTAGTGGTACTCCTG -3'
(R):5'- TGCCACAAGTTCCAGGTTAG -3'
Posted On2016-04-15