Incidental Mutation 'R4930:Spdef'
ID381194
Institutional Source Beutler Lab
Gene Symbol Spdef
Ensembl Gene ENSMUSG00000024215
Gene NameSAM pointed domain containing ets transcription factor
SynonymsPse, PDEF
MMRRC Submission 042531-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R4930 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27714352-27728951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27718162 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 156 (Y156H)
Ref Sequence ENSEMBL: ENSMUSP00000127056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025054] [ENSMUST00000114870] [ENSMUST00000138970] [ENSMUST00000167489]
Predicted Effect probably damaging
Transcript: ENSMUST00000025054
AA Change: Y156H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025054
Gene: ENSMUSG00000024215
AA Change: Y156H

DomainStartEndE-ValueType
SAM_PNT 121 203 4.68e-33 SMART
ETS 238 325 4.06e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114870
AA Change: Y156H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110520
Gene: ENSMUSG00000024215
AA Change: Y156H

DomainStartEndE-ValueType
SAM_PNT 121 203 4.68e-33 SMART
ETS 238 325 4.06e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127622
Predicted Effect probably benign
Transcript: ENSMUST00000138970
Predicted Effect probably damaging
Transcript: ENSMUST00000167489
AA Change: Y156H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127056
Gene: ENSMUSG00000024215
AA Change: Y156H

DomainStartEndE-ValueType
SAM_PNT 121 203 4.68e-33 SMART
ETS 238 325 4.06e-45 SMART
Meta Mutation Damage Score 0.4772 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele have reduced numbers of intestinal and respiratory mucosa goblet cells. Increased inflammation of the gastric antrum has also been seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C T 12: 72,906,234 E242K possibly damaging Het
A930011G23Rik A G 5: 99,222,404 M499T possibly damaging Het
Abcb8 G A 5: 24,400,781 V196M possibly damaging Het
Ahnak T C 19: 9,010,967 M3205T possibly damaging Het
Ankrd1 A G 19: 36,115,033 Y265H probably damaging Het
Apeh A G 9: 108,087,825 S446P probably benign Het
Apip C A 2: 103,091,881 Y197* probably null Het
Arhgef11 T G 3: 87,728,594 V925G probably damaging Het
Arid4b T C 13: 14,187,477 V929A probably damaging Het
Asah2 T A 19: 32,052,906 D122V probably benign Het
B2m A T 2: 122,151,647 D116V possibly damaging Het
BC067074 G T 13: 113,327,662 G1453C probably damaging Het
Bhmt-ps1 A G 4: 26,369,184 noncoding transcript Het
Cacna1g T A 11: 94,444,073 I803F probably damaging Het
Ccdc43 A T 11: 102,690,285 V113E probably damaging Het
Cenpj A T 14: 56,534,781 Y388* probably null Het
Chd3 G A 11: 69,354,208 probably benign Het
Chil3 C T 3: 106,164,208 D47N possibly damaging Het
Colgalt2 A G 1: 152,499,959 T361A possibly damaging Het
Cops3 C A 11: 59,835,367 probably benign Het
Crb2 G T 2: 37,783,314 G74V probably damaging Het
Cyp20a1 A T 1: 60,366,719 Y224F probably damaging Het
Diaph3 A G 14: 87,141,166 probably benign Het
Dnah3 A T 7: 119,951,681 Y3127* probably null Het
Eef1akmt3 A C 10: 127,041,355 S14A possibly damaging Het
Ehf C A 2: 103,266,857 R250L probably damaging Het
Eps8l1 G A 7: 4,460,916 R13Q possibly damaging Het
Frem2 A C 3: 53,656,315 V257G possibly damaging Het
Gc T C 5: 89,439,589 T259A probably benign Het
Gm4952 A T 19: 12,627,012 N263Y probably benign Het
Gpcpd1 T A 2: 132,546,874 H326L probably damaging Het
Helz T C 11: 107,620,168 F617L probably damaging Het
Hoxb4 T C 11: 96,318,836 Y23H probably damaging Het
Hsf4 T A 8: 105,272,698 probably null Het
Ighv1-81 T C 12: 115,920,304 D109G probably damaging Het
Irx4 T C 13: 73,268,913 V476A probably benign Het
Katnb1 T A 8: 95,097,294 probably null Het
L3mbtl1 A G 2: 162,965,772 Y490C probably damaging Het
Lemd2 A G 17: 27,193,832 probably null Het
Lrrc38 A T 4: 143,369,868 T250S probably damaging Het
Map3k8 A T 18: 4,349,215 Y34* probably null Het
Mgst1 T A 6: 138,153,509 F79I probably benign Het
Midn T C 10: 80,155,355 S357P probably benign Het
Mmp3 T A 9: 7,447,640 D208E probably benign Het
Mrps26 A G 2: 130,564,942 E163G probably damaging Het
Mycbpap A T 11: 94,503,157 M371K probably benign Het
Mynn A C 3: 30,607,042 N91T probably damaging Het
Nek11 A G 9: 105,300,066 L292P probably damaging Het
Nid1 A T 13: 13,510,011 R1228W probably damaging Het
Nphs2 T C 1: 156,320,929 Y121H probably damaging Het
Olfr1020 T A 2: 85,849,893 I147N probably benign Het
Olfr1166 A C 2: 88,124,340 I215S probably benign Het
Olfr1178 G A 2: 88,391,940 R231H probably benign Het
Olfr1497 T C 19: 13,795,551 H20R probably benign Het
Olfr161 T G 16: 3,592,435 L13R probably damaging Het
Olfr204 C A 16: 59,314,873 C178F probably damaging Het
Olfr872 T C 9: 20,260,017 I59T probably damaging Het
P2rx7 C T 5: 122,670,479 T308M probably damaging Het
Prdx6 C T 1: 161,241,693 probably benign Het
Rad54b T A 4: 11,615,579 D862E probably damaging Het
Ripor1 A G 8: 105,617,182 Y344C probably damaging Het
Rnf112 T C 11: 61,453,465 M43V probably benign Het
Rp1l1 A G 14: 64,032,206 N1747S probably benign Het
Rps27 A G 3: 90,212,999 V22A probably damaging Het
Spaca1 A G 4: 34,044,236 V86A possibly damaging Het
Specc1 A C 11: 62,118,958 E433D possibly damaging Het
Srpr T A 9: 35,215,030 F506L probably benign Het
Stxbp5 A G 10: 9,760,866 probably benign Het
Syne1 C T 10: 5,052,777 R8046Q probably damaging Het
Tbx5 T A 5: 119,883,025 S365R probably benign Het
Terb1 G T 8: 104,447,948 P698Q probably benign Het
Tmbim7 T A 5: 3,661,948 Y27* probably null Het
Tmem106c C A 15: 97,965,028 A60E possibly damaging Het
Ttc26 A T 6: 38,391,540 Y174F probably damaging Het
Ttc6 T A 12: 57,673,823 probably null Het
Ttn T C 2: 76,732,370 I28747V possibly damaging Het
Unc13a C T 8: 71,630,504 probably null Het
Wdr81 T C 11: 75,451,924 D839G probably benign Het
Wfdc15a G C 2: 164,199,805 Q33E probably benign Het
Zfp456 T C 13: 67,366,946 R214G probably benign Het
Zfp457 T A 13: 67,294,100 Y137F probably damaging Het
Other mutations in Spdef
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:Spdef UTSW 17 27714920 missense probably damaging 1.00
R0211:Spdef UTSW 17 27714920 missense probably damaging 1.00
R0497:Spdef UTSW 17 27718058 missense probably benign 0.02
R0972:Spdef UTSW 17 27715023 missense probably damaging 1.00
R2255:Spdef UTSW 17 27720295 missense probably benign 0.01
R7151:Spdef UTSW 17 27720160 missense possibly damaging 0.92
R7339:Spdef UTSW 17 27720245 missense probably benign
R7392:Spdef UTSW 17 27717288 missense probably benign 0.06
V8831:Spdef UTSW 17 27718077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTAGCCCAGTTTACCG -3'
(R):5'- AACAAGCTTGGTTTAGGGTCTTTC -3'

Sequencing Primer
(F):5'- GTGTCTCACCTGACTTCCAGATG -3'
(R):5'- TTTAGACATTCCCACCCTGAGGAG -3'
Posted On2016-04-15