Incidental Mutation 'R4930:Map3k8'
ID381196
Institutional Source Beutler Lab
Gene Symbol Map3k8
Ensembl Gene ENSMUSG00000024235
Gene Namemitogen-activated protein kinase kinase kinase 8
SynonymsTpl2, Tpl-2, c-COT, Cot, Cot/Tpl2
MMRRC Submission 042531-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4930 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location4331327-4353015 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 4349215 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 34 (Y34*)
Ref Sequence ENSEMBL: ENSMUSP00000133469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025078] [ENSMUST00000173930]
Predicted Effect probably null
Transcript: ENSMUST00000025078
AA Change: Y34*
SMART Domains Protein: ENSMUSP00000025078
Gene: ENSMUSG00000024235
AA Change: Y34*

DomainStartEndE-ValueType
Pfam:Pkinase 137 388 1.1e-47 PFAM
Pfam:Pkinase_Tyr 139 386 4.6e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172805
Predicted Effect probably null
Transcript: ENSMUST00000173930
AA Change: Y34*
SMART Domains Protein: ENSMUSP00000133469
Gene: ENSMUSG00000024235
AA Change: Y34*

DomainStartEndE-ValueType
SCOP:d1phk__ 146 169 2e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice resist endotoxic shock. Their MHC II expression is enhanced. Macrophages' TNF-alpha response to viruses and to all TLR ligands is impaired. Macrophage and T-cell secretion of other cytokines in response to various TLR ligands or OVA is aberrant. Anti-OVA Ig classes are abnormally skewed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C T 12: 72,906,234 E242K possibly damaging Het
A930011G23Rik A G 5: 99,222,404 M499T possibly damaging Het
Abcb8 G A 5: 24,400,781 V196M possibly damaging Het
Ahnak T C 19: 9,010,967 M3205T possibly damaging Het
Ankrd1 A G 19: 36,115,033 Y265H probably damaging Het
Apeh A G 9: 108,087,825 S446P probably benign Het
Apip C A 2: 103,091,881 Y197* probably null Het
Arhgef11 T G 3: 87,728,594 V925G probably damaging Het
Arid4b T C 13: 14,187,477 V929A probably damaging Het
Asah2 T A 19: 32,052,906 D122V probably benign Het
B2m A T 2: 122,151,647 D116V possibly damaging Het
BC067074 G T 13: 113,327,662 G1453C probably damaging Het
Bhmt-ps1 A G 4: 26,369,184 noncoding transcript Het
Cacna1g T A 11: 94,444,073 I803F probably damaging Het
Ccdc43 A T 11: 102,690,285 V113E probably damaging Het
Cenpj A T 14: 56,534,781 Y388* probably null Het
Chd3 G A 11: 69,354,208 probably benign Het
Chil3 C T 3: 106,164,208 D47N possibly damaging Het
Colgalt2 A G 1: 152,499,959 T361A possibly damaging Het
Cops3 C A 11: 59,835,367 probably benign Het
Crb2 G T 2: 37,783,314 G74V probably damaging Het
Cyp20a1 A T 1: 60,366,719 Y224F probably damaging Het
Diaph3 A G 14: 87,141,166 probably benign Het
Dnah3 A T 7: 119,951,681 Y3127* probably null Het
Eef1akmt3 A C 10: 127,041,355 S14A possibly damaging Het
Ehf C A 2: 103,266,857 R250L probably damaging Het
Eps8l1 G A 7: 4,460,916 R13Q possibly damaging Het
Frem2 A C 3: 53,656,315 V257G possibly damaging Het
Gc T C 5: 89,439,589 T259A probably benign Het
Gm4952 A T 19: 12,627,012 N263Y probably benign Het
Gpcpd1 T A 2: 132,546,874 H326L probably damaging Het
Helz T C 11: 107,620,168 F617L probably damaging Het
Hoxb4 T C 11: 96,318,836 Y23H probably damaging Het
Hsf4 T A 8: 105,272,698 probably null Het
Ighv1-81 T C 12: 115,920,304 D109G probably damaging Het
Irx4 T C 13: 73,268,913 V476A probably benign Het
Katnb1 T A 8: 95,097,294 probably null Het
L3mbtl1 A G 2: 162,965,772 Y490C probably damaging Het
Lemd2 A G 17: 27,193,832 probably null Het
Lrrc38 A T 4: 143,369,868 T250S probably damaging Het
Mgst1 T A 6: 138,153,509 F79I probably benign Het
Midn T C 10: 80,155,355 S357P probably benign Het
Mmp3 T A 9: 7,447,640 D208E probably benign Het
Mrps26 A G 2: 130,564,942 E163G probably damaging Het
Mycbpap A T 11: 94,503,157 M371K probably benign Het
Mynn A C 3: 30,607,042 N91T probably damaging Het
Nek11 A G 9: 105,300,066 L292P probably damaging Het
Nid1 A T 13: 13,510,011 R1228W probably damaging Het
Nphs2 T C 1: 156,320,929 Y121H probably damaging Het
Olfr1020 T A 2: 85,849,893 I147N probably benign Het
Olfr1166 A C 2: 88,124,340 I215S probably benign Het
Olfr1178 G A 2: 88,391,940 R231H probably benign Het
Olfr1497 T C 19: 13,795,551 H20R probably benign Het
Olfr161 T G 16: 3,592,435 L13R probably damaging Het
Olfr204 C A 16: 59,314,873 C178F probably damaging Het
Olfr872 T C 9: 20,260,017 I59T probably damaging Het
P2rx7 C T 5: 122,670,479 T308M probably damaging Het
Prdx6 C T 1: 161,241,693 probably benign Het
Rad54b T A 4: 11,615,579 D862E probably damaging Het
Ripor1 A G 8: 105,617,182 Y344C probably damaging Het
Rnf112 T C 11: 61,453,465 M43V probably benign Het
Rp1l1 A G 14: 64,032,206 N1747S probably benign Het
Rps27 A G 3: 90,212,999 V22A probably damaging Het
Spaca1 A G 4: 34,044,236 V86A possibly damaging Het
Spdef A G 17: 27,718,162 Y156H probably damaging Het
Specc1 A C 11: 62,118,958 E433D possibly damaging Het
Srpr T A 9: 35,215,030 F506L probably benign Het
Stxbp5 A G 10: 9,760,866 probably benign Het
Syne1 C T 10: 5,052,777 R8046Q probably damaging Het
Tbx5 T A 5: 119,883,025 S365R probably benign Het
Terb1 G T 8: 104,447,948 P698Q probably benign Het
Tmbim7 T A 5: 3,661,948 Y27* probably null Het
Tmem106c C A 15: 97,965,028 A60E possibly damaging Het
Ttc26 A T 6: 38,391,540 Y174F probably damaging Het
Ttc6 T A 12: 57,673,823 probably null Het
Ttn T C 2: 76,732,370 I28747V possibly damaging Het
Unc13a C T 8: 71,630,504 probably null Het
Wdr81 T C 11: 75,451,924 D839G probably benign Het
Wfdc15a G C 2: 164,199,805 Q33E probably benign Het
Zfp456 T C 13: 67,366,946 R214G probably benign Het
Zfp457 T A 13: 67,294,100 Y137F probably damaging Het
Other mutations in Map3k8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Map3k8 APN 18 4334660 missense probably damaging 1.00
IGL02483:Map3k8 APN 18 4349318 utr 5 prime probably benign
IGL03174:Map3k8 APN 18 4349247 missense probably damaging 1.00
Flojo UTSW 18 4339548 missense possibly damaging 0.95
gnostic_gospel UTSW 18 4333965 missense probably damaging 1.00
juicy UTSW 18 4339552 missense probably damaging 0.99
Sluggish UTSW 18 4339608 splice site probably benign
R0304:Map3k8 UTSW 18 4339552 missense probably damaging 0.99
R0569:Map3k8 UTSW 18 4349162 missense probably benign 0.00
R1748:Map3k8 UTSW 18 4334766 missense probably damaging 1.00
R1793:Map3k8 UTSW 18 4332389 nonsense probably null
R2310:Map3k8 UTSW 18 4349001 missense probably benign
R3625:Map3k8 UTSW 18 4333965 missense probably damaging 1.00
R4786:Map3k8 UTSW 18 4340647 nonsense probably null
R4921:Map3k8 UTSW 18 4349124 missense possibly damaging 0.92
R4934:Map3k8 UTSW 18 4339548 missense possibly damaging 0.95
R4956:Map3k8 UTSW 18 4339530 missense probably benign 0.00
R5241:Map3k8 UTSW 18 4340750 missense probably damaging 0.98
R5549:Map3k8 UTSW 18 4340762 missense probably damaging 0.98
R6317:Map3k8 UTSW 18 4348979 critical splice donor site probably null
R6326:Map3k8 UTSW 18 4340651 missense probably damaging 1.00
R6910:Map3k8 UTSW 18 4340801 missense probably benign 0.03
R7010:Map3k8 UTSW 18 4334060 missense probably damaging 1.00
R7247:Map3k8 UTSW 18 4334036 missense probably damaging 1.00
R7300:Map3k8 UTSW 18 4349076 missense probably damaging 0.98
R7348:Map3k8 UTSW 18 4340561 missense probably damaging 1.00
R7903:Map3k8 UTSW 18 4349162 missense probably benign 0.00
R7986:Map3k8 UTSW 18 4349162 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAGACATGGTTTGCAAATG -3'
(R):5'- TCCTTGTTATGAACAGAGGCAC -3'

Sequencing Primer
(F):5'- TGCAAGCAGATCCTCCACGG -3'
(R):5'- AGCAGATCTCCAGGCCCTTTG -3'
Posted On2016-04-15