Incidental Mutation 'R4466:Stag2'
ID381205
Institutional Source Beutler Lab
Gene Symbol Stag2
Ensembl Gene ENSMUSG00000025862
Gene Namestromal antigen 2
Synonymsnuclear protein SA2, SA-2, 9230105L23Rik, SAP2, B230112I07Rik
MMRRC Submission 041723-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R4466 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location42149317-42277185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42233872 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 400 (S400G)
Ref Sequence ENSEMBL: ENSMUSP00000110725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069619] [ENSMUST00000115072] [ENSMUST00000115073]
Predicted Effect probably benign
Transcript: ENSMUST00000069619
AA Change: S400G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063250
Gene: ENSMUSG00000025862
AA Change: S400G

DomainStartEndE-ValueType
low complexity region 32 68 N/A INTRINSIC
Pfam:STAG 154 273 3e-50 PFAM
SCOP:d1b3ua_ 275 439 2e-3 SMART
low complexity region 501 513 N/A INTRINSIC
low complexity region 1096 1101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115072
AA Change: S400G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110724
Gene: ENSMUSG00000025862
AA Change: S400G

DomainStartEndE-ValueType
low complexity region 32 68 N/A INTRINSIC
Pfam:STAG 154 273 3e-50 PFAM
SCOP:d1b3ua_ 275 439 2e-3 SMART
low complexity region 501 513 N/A INTRINSIC
low complexity region 1096 1101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115073
AA Change: S400G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110725
Gene: ENSMUSG00000025862
AA Change: S400G

DomainStartEndE-ValueType
low complexity region 32 68 N/A INTRINSIC
Pfam:STAG 157 271 6.3e-41 PFAM
SCOP:d1b3ua_ 275 439 2e-3 SMART
low complexity region 501 513 N/A INTRINSIC
low complexity region 1096 1101 N/A INTRINSIC
coiled coil region 1169 1189 N/A INTRINSIC
Meta Mutation Damage Score 0.0839 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the cohesin complex, which regulates the separation of sister chromatids during cell division. Targeted inactivation of this gene results in chromatid cohesion defects and aneuploidy, suggesting that genetic disruption of cohesin is a cause of aneuploidy in human cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Knockdown of expression of this gene results in lineage skewing of hematopoietic stem cells and myeloproliferative disorders in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A T 3: 59,838,466 noncoding transcript Het
Adgra1 T A 7: 139,840,836 probably benign Het
Akap13 T A 7: 75,602,773 probably null Het
Amn1 T C 6: 149,166,845 probably null Het
Ano5 T A 7: 51,570,275 F374I probably damaging Het
Apol7c T C 15: 77,526,464 E94G probably benign Het
Arid4b A T 13: 14,132,510 S117C probably damaging Het
Atm C A 9: 53,448,169 E2778* probably null Het
Cped1 A T 6: 22,123,652 Q468L probably benign Het
Crygb A G 1: 65,080,486 S112P probably damaging Het
Eml4 C T 17: 83,421,674 Q93* probably null Het
Eps15 G A 4: 109,366,530 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam102b T A 3: 108,979,808 R291S probably benign Het
Fhad1 A T 4: 141,957,658 S457T probably damaging Het
Frmd4b A G 6: 97,323,653 probably null Het
Gm5134 G C 10: 76,008,575 K588N probably benign Het
Gpr21 A G 2: 37,517,558 T39A probably benign Het
Irx1 C A 13: 71,959,982 G194W probably damaging Het
Itgal C T 7: 127,328,512 T992I possibly damaging Het
Itpr3 T C 17: 27,106,342 L1303P probably damaging Het
Kdm2a A T 19: 4,320,300 D1052E probably damaging Het
Klhl6 T C 16: 19,957,268 D180G probably damaging Het
M6pr A G 6: 122,313,269 T64A probably benign Het
Mrpl47 G A 3: 32,730,091 R177* probably null Het
Mtfr2 A G 10: 20,348,413 Y31C probably damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Oas2 A G 5: 120,749,602 S58P probably damaging Het
Olfr1489 G A 19: 13,633,437 E109K probably damaging Het
Olfr339 A T 2: 36,422,296 R299S probably benign Het
Olfr883 T A 9: 38,026,183 C126S probably damaging Het
Polr1b A T 2: 129,123,882 I815L probably benign Het
Psma8 T C 18: 14,721,174 I37T possibly damaging Het
Ryr3 T C 2: 112,653,102 E4100G possibly damaging Het
Serpina3g C T 12: 104,237,923 probably benign Het
Serpina3m A T 12: 104,391,615 Y266F probably damaging Het
Sez6l2 T A 7: 126,959,851 D423E probably damaging Het
Sh3gl2 A G 4: 85,381,451 E224G possibly damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc24a2 A T 4: 87,227,862 probably benign Het
Smyd2 A G 1: 189,882,152 M393T probably benign Het
Sox8 C A 17: 25,568,905 G190V probably benign Het
Stk35 C A 2: 129,801,516 T140K probably damaging Het
Taf6 A C 5: 138,181,201 probably benign Het
Ten1 A C 11: 116,204,997 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttn A G 2: 76,713,700 F32981L probably damaging Het
Zik1 G T 7: 10,490,966 T68K probably benign Het
Zzef1 T A 11: 72,924,659 I2935N probably damaging Het
Other mutations in Stag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Stag2 APN X 42247015 missense probably benign 0.17
IGL02379:Stag2 APN X 42250597 missense probably benign 0.00
IGL02501:Stag2 APN X 42271325 splice site probably benign
R0194:Stag2 UTSW X 42206137 splice site probably benign
R4057:Stag2 UTSW X 42224942 missense probably damaging 1.00
R4465:Stag2 UTSW X 42233872 missense probably benign 0.00
R4467:Stag2 UTSW X 42233872 missense probably benign 0.00
R5007:Stag2 UTSW X 42266253 missense possibly damaging 0.92
Z1177:Stag2 UTSW X 42229398 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGTCATCTTTCATCTTGATACAC -3'
(R):5'- AGTGCTTGCATCAAACCAAG -3'

Sequencing Primer
(F):5'- CATCTTTCATCTTGATACACTGAACG -3'
(R):5'- GCTTGCATCAAACCAAGTAAATATTC -3'
Posted On2016-04-15