Incidental Mutation 'R4637:Clic6'
ID381215
Institutional Source Beutler Lab
Gene Symbol Clic6
Ensembl Gene ENSMUSG00000022949
Gene Namechloride intracellular channel 6
SynonymsCLIC1L, 5730466J16Rik
MMRRC Submission 042010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R4637 (G1)
Quality Score60
Status Validated
Chromosome16
Chromosomal Location92485736-92541243 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 92497061 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023670] [ENSMUST00000162181]
Predicted Effect probably benign
Transcript: ENSMUST00000023670
SMART Domains Protein: ENSMUSP00000023670
Gene: ENSMUSG00000022949

DomainStartEndE-ValueType
low complexity region 38 46 N/A INTRINSIC
low complexity region 62 74 N/A INTRINSIC
low complexity region 83 108 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
low complexity region 308 318 N/A INTRINSIC
Pfam:GST_N_3 375 447 2e-9 PFAM
Pfam:GST_C_2 478 567 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160494
SMART Domains Protein: ENSMUSP00000123968
Gene: ENSMUSG00000051297

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162181
SMART Domains Protein: ENSMUSP00000124498
Gene: ENSMUSG00000022949

DomainStartEndE-ValueType
Pfam:GST_N_3 34 100 2.8e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (27/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chloride intracellular channel family of proteins. The gene is part of a large triplicated region found on chromosomes 1, 6, and 21. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,488,091 R396Q probably benign Het
Art1 T A 7: 102,106,337 V12E probably damaging Het
Ccdc180 A G 4: 45,914,443 S653G probably benign Het
Fras1 T A 5: 96,778,088 L3717Q probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Gtf2f1 G T 17: 57,004,534 P292H probably benign Het
Hcn1 A T 13: 117,975,713 T738S unknown Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmbs A G 9: 44,339,537 S130P probably damaging Het
Kif1b A T 4: 149,199,311 I1299N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Muc3 A T 5: 137,146,654 L56Q probably damaging Het
Myd88 G A 9: 119,338,109 probably null Het
Nol6 G A 4: 41,121,788 R249W probably damaging Het
Olfr1284 C T 2: 111,379,582 T194I probably benign Het
Pcdhb1 T C 18: 37,265,749 V251A possibly damaging Het
Prkcd A G 14: 30,598,765 S633P probably benign Het
Rarb T C 14: 16,574,875 H47R possibly damaging Het
Slc16a14 A G 1: 84,907,282 V512A possibly damaging Het
Slc34a3 C T 2: 25,229,461 V466M possibly damaging Het
Stat3 A G 11: 100,893,230 S623P probably damaging Het
Vmn2r16 T G 5: 109,330,414 S12A probably benign Het
Zfhx4 C G 3: 5,403,404 P2874R probably damaging Het
Zfp3 T C 11: 70,771,355 S47P probably benign Het
Zfp791 T C 8: 85,109,885 E450G possibly damaging Het
Other mutations in Clic6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Clic6 APN 16 92499308 missense probably damaging 0.99
IGL02104:Clic6 APN 16 92498479 missense possibly damaging 0.72
IGL02387:Clic6 APN 16 92529919 missense probably damaging 1.00
IGL02437:Clic6 APN 16 92530929 missense probably damaging 1.00
IGL02617:Clic6 APN 16 92499318 missense probably benign 0.00
unsweetened UTSW 16 92530809 missense possibly damaging 0.79
R1544:Clic6 UTSW 16 92492073 intron probably benign
R1677:Clic6 UTSW 16 92528084 missense probably damaging 1.00
R2149:Clic6 UTSW 16 92499207 missense probably benign 0.00
R3965:Clic6 UTSW 16 92498844 missense probably benign 0.00
R4171:Clic6 UTSW 16 92497061 intron probably benign
R4545:Clic6 UTSW 16 92492157 intron probably benign
R4649:Clic6 UTSW 16 92530939 critical splice donor site probably null
R5159:Clic6 UTSW 16 92528066 missense probably benign 0.13
R5249:Clic6 UTSW 16 92539451 missense probably damaging 1.00
R5486:Clic6 UTSW 16 92529852 intron probably null
R5582:Clic6 UTSW 16 92499454 missense possibly damaging 0.93
R6140:Clic6 UTSW 16 92539492 missense probably damaging 1.00
R6234:Clic6 UTSW 16 92499222 missense probably benign
R6379:Clic6 UTSW 16 92539535 missense probably damaging 1.00
R6593:Clic6 UTSW 16 92528117 missense possibly damaging 0.82
R7890:Clic6 UTSW 16 92499387 missense probably benign 0.41
RF012:Clic6 UTSW 16 92530809 missense possibly damaging 0.79
X0058:Clic6 UTSW 16 92498707 missense probably benign
Z1176:Clic6 UTSW 16 92498895 missense probably benign 0.26
Z1177:Clic6 UTSW 16 92499139 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGCTCCATCATTCTTAGGCAAC -3'
(R):5'- AACTGGGCCAGGAGTCCC -3'

Sequencing Primer
(F):5'- CCAGCATTTTATCGAGACGTGACG -3'
(R):5'- AACTGTGAGGCCAGCATTTC -3'
Posted On2016-04-19