Incidental Mutation 'R4478:6430531B16Rik'
ID381216
Institutional Source Beutler Lab
Gene Symbol 6430531B16Rik
Ensembl Gene ENSMUSG00000073795
Gene NameRIKEN cDNA 6430531B16 gene
SynonymsLOC381933
MMRRC Submission 041735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4478 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location139972303-139978755 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 139975860 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026546] [ENSMUST00000097970] [ENSMUST00000097970] [ENSMUST00000106069] [ENSMUST00000121412] [ENSMUST00000209335] [ENSMUST00000210254]
Predicted Effect probably benign
Transcript: ENSMUST00000026546
SMART Domains Protein: ENSMUSP00000026546
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 5.9e-35 PFAM
Pfam:Reprolysin_5 193 371 1e-22 PFAM
Pfam:Reprolysin_4 193 384 1.7e-16 PFAM
Pfam:Reprolysin 195 394 2.7e-70 PFAM
Pfam:Reprolysin_2 214 384 1.6e-16 PFAM
Pfam:Reprolysin_3 218 339 4.9e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 606 2.15e-35 SMART
EGF 613 642 3.06e-1 SMART
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 732 762 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
low complexity region 784 812 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097970
SMART Domains Protein: ENSMUSP00000095584
Gene: ENSMUSG00000073795

DomainStartEndE-ValueType
Pfam:CH_2 22 118 3e-35 PFAM
Pfam:CAMSAP_CH 23 105 1.2e-21 PFAM
coiled coil region 237 276 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097970
SMART Domains Protein: ENSMUSP00000095584
Gene: ENSMUSG00000073795

DomainStartEndE-ValueType
Pfam:CH_2 22 118 3e-35 PFAM
Pfam:CAMSAP_CH 23 105 1.2e-21 PFAM
coiled coil region 237 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106069
SMART Domains Protein: ENSMUSP00000101684
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 152 4e-30 PFAM
Pfam:Reprolysin_5 194 372 9.6e-23 PFAM
Pfam:Reprolysin_4 194 385 1.6e-16 PFAM
Pfam:Reprolysin 196 395 2.2e-73 PFAM
Pfam:Reprolysin_2 215 385 2.9e-18 PFAM
Pfam:Reprolysin_3 219 340 6.6e-21 PFAM
DISIN 412 487 5.16e-36 SMART
ACR 488 607 2.15e-35 SMART
EGF 614 643 3.06e-1 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 733 763 N/A INTRINSIC
low complexity region 771 784 N/A INTRINSIC
low complexity region 785 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121412
SMART Domains Protein: ENSMUSP00000113338
Gene: ENSMUSG00000073795

DomainStartEndE-ValueType
Pfam:DUF1042 22 153 4.5e-35 PFAM
Pfam:CAMSAP_CH 23 105 1.3e-20 PFAM
low complexity region 230 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156647
Predicted Effect probably null
Transcript: ENSMUST00000209335
Predicted Effect probably benign
Transcript: ENSMUST00000210254
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 94% (46/49)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,695,155 D509G probably benign Het
Ank1 C T 8: 23,120,578 T1379I probably benign Het
Ap1m2 A G 9: 21,298,213 V389A probably benign Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
Chd9 T C 8: 91,034,031 probably benign Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cpne5 T C 17: 29,209,476 T118A probably damaging Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dag1 G C 9: 108,208,730 T404R probably damaging Het
Dnah3 T G 7: 120,071,863 H599P probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fabp9 T C 3: 10,197,106 Y30C probably damaging Het
Fnbp1 G A 2: 31,105,254 A56V probably damaging Het
Gm20498 T C 12: 81,489,216 probably benign Het
Hid1 G A 11: 115,361,655 A67V probably damaging Het
Il6ra T A 3: 89,890,290 Y90F probably damaging Het
Kcnk18 T C 19: 59,235,244 S274P probably damaging Het
Kndc1 A T 7: 139,920,684 D655V probably damaging Het
Lrrk2 G A 15: 91,723,188 A585T probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo9b A T 8: 71,291,081 K262M probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1100 G T 2: 86,978,218 R193S probably benign Het
Olfr433 C T 1: 174,042,616 T222I probably benign Het
Olfr779 C T 10: 129,311,776 L90F possibly damaging Het
Plxna4 A T 6: 32,196,133 C1288S possibly damaging Het
Ptpn22 T C 3: 103,902,064 probably benign Het
Rab11fip3 C T 17: 26,016,083 E619K probably damaging Het
Robo2 C A 16: 74,015,873 R311L probably damaging Het
Sdad1 A G 5: 92,297,160 M315T probably damaging Het
Slc39a12 T A 2: 14,420,179 L407* probably null Het
Snap29 T C 16: 17,428,155 V213A probably benign Het
Stard7 T A 2: 127,284,259 L77Q probably damaging Het
Stat5b A G 11: 100,787,284 Y668H probably benign Het
Tgfb2 A G 1: 186,632,499 I266T probably damaging Het
Tmem87a C T 2: 120,369,343 W440* probably null Het
Tnr T A 1: 159,884,756 probably null Het
Ubl3 C T 5: 148,511,977 S18N probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r9 T C 5: 108,846,277 E502G probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Vwa8 T A 14: 78,868,801 D61E probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp1 A G 8: 111,670,543 R366G probably damaging Het
Zfp282 A T 6: 47,890,696 R269* probably null Het
Other mutations in 6430531B16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:6430531B16Rik APN 7 139978103 missense probably damaging 1.00
IGL01900:6430531B16Rik APN 7 139972570 missense probably damaging 1.00
IGL03395:6430531B16Rik APN 7 139976676 splice site probably benign
R0562:6430531B16Rik UTSW 7 139977113 missense probably benign 0.01
R1121:6430531B16Rik UTSW 7 139976630 missense probably benign 0.00
R1474:6430531B16Rik UTSW 7 139976642 missense probably benign
R1844:6430531B16Rik UTSW 7 139976092 missense probably benign 0.06
R2680:6430531B16Rik UTSW 7 139978561 missense probably damaging 1.00
R3113:6430531B16Rik UTSW 7 139975965 splice site probably benign
R4576:6430531B16Rik UTSW 7 139978130 missense probably damaging 1.00
R4577:6430531B16Rik UTSW 7 139978130 missense probably damaging 1.00
R5037:6430531B16Rik UTSW 7 139978674 missense possibly damaging 0.84
R5935:6430531B16Rik UTSW 7 139976613 missense probably benign 0.37
R6314:6430531B16Rik UTSW 7 139976489 missense possibly damaging 0.92
R6361:6430531B16Rik UTSW 7 139976672 missense possibly damaging 0.55
R7326:6430531B16Rik UTSW 7 139978545 critical splice donor site probably null
R7386:6430531B16Rik UTSW 7 139976052 nonsense probably null
R7658:6430531B16Rik UTSW 7 139976618 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCCTCTGAGAAGGACTG -3'
(R):5'- AAAATGGGCTGCTGTGCTTG -3'

Sequencing Primer
(F):5'- GCCTGATGAATCACCATTGCTAGG -3'
(R):5'- GGGTGGACCTTTATCTCTCAAATTC -3'
Posted On2016-04-20