Incidental Mutation 'R4463:Alox12e'
ID 381228
Institutional Source Beutler Lab
Gene Symbol Alox12e
Ensembl Gene ENSMUSG00000018907
Gene Name arachidonate lipoxygenase, epidermal
Synonyms 8-LOX, Alox12-ps1, Alox12-ps2, Aloxe, e-LOX1
MMRRC Submission 041721-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4463 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 70315610-70322628 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70318256 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 388 (L388P)
Ref Sequence ENSEMBL: ENSMUSP00000019051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019051]
AlphaFold P55249
Predicted Effect probably damaging
Transcript: ENSMUST00000019051
AA Change: L388P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019051
Gene: ENSMUSG00000018907
AA Change: L388P

DomainStartEndE-ValueType
LH2 2 111 9.49e-38 SMART
Pfam:Lipoxygenase 163 649 1.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149060
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,150,719 M1197V probably benign Het
Abcb1a T C 5: 8,719,981 probably benign Het
Abcc8 T C 7: 46,106,581 probably null Het
Aspm T A 1: 139,455,010 S27T possibly damaging Het
Capn2 G A 1: 182,479,764 probably benign Het
Catspere1 G A 1: 177,937,713 noncoding transcript Het
Ccdc158 T C 5: 92,634,300 D820G probably null Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Chd9 T A 8: 90,978,999 D761E probably benign Het
Chst8 T C 7: 34,675,220 D398G probably damaging Het
Clns1a T C 7: 97,720,949 probably benign Het
Cyp3a57 A T 5: 145,381,274 Y355F probably damaging Het
Cyp4f37 A G 17: 32,627,736 probably null Het
Eipr1 G A 12: 28,859,339 A202T probably damaging Het
Fam83a T C 15: 57,995,259 S232P probably damaging Het
Fastkd2 C T 1: 63,735,809 probably benign Het
Fgfr4 G A 13: 55,156,467 V107I probably benign Het
Gatad1 G T 5: 3,647,404 S72R probably benign Het
Gli2 T C 1: 118,836,008 D1471G probably damaging Het
Gm1330 A T 2: 149,003,144 Y36* probably null Het
Gm2056 A G 12: 88,027,359 D119G probably benign Het
Gm29125 T C 1: 80,383,186 noncoding transcript Het
Idi1 G A 13: 8,887,472 probably benign Het
Itgbl1 C T 14: 123,840,668 T190I probably damaging Het
Kbtbd3 G A 9: 4,331,257 G544R probably damaging Het
Kifc3 T C 8: 95,102,116 T638A probably damaging Het
Lama1 G A 17: 67,761,700 C798Y probably damaging Het
Larp6 C A 9: 60,736,996 H140N probably damaging Het
Mctp1 A T 13: 76,712,087 D108V probably damaging Het
Myzap G T 9: 71,555,651 D204E probably benign Het
Neb GCC GC 2: 52,279,722 probably null Het
Olfr1189 T C 2: 88,592,632 V276A possibly damaging Het
Olfr1340 T C 4: 118,726,658 V137A probably benign Het
Olfr352 T C 2: 36,870,193 I209T probably benign Het
Phka1 A G X: 102,545,384 V818A probably benign Het
Plek T C 11: 16,981,873 Y326C possibly damaging Het
Pp2d1 A G 17: 53,515,858 I60T probably benign Het
Prmt3 T C 7: 49,818,089 Y348H probably damaging Het
Psg27 G T 7: 18,557,085 Q398K possibly damaging Het
Raver1 T C 9: 21,091,827 T51A probably benign Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Sectm1a T A 11: 121,069,651 I113L probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Snph A T 2: 151,594,115 S229T probably damaging Het
Stpg4 A G 17: 87,389,673 F183L probably benign Het
Tango6 A T 8: 106,689,074 T176S probably benign Het
Vmn1r196 A G 13: 22,293,683 Q164R probably benign Het
Vstm4 T A 14: 32,917,876 L236Q probably damaging Het
Xylb A G 9: 119,386,367 D462G probably benign Het
Zc2hc1c A G 12: 85,290,297 R243G probably damaging Het
Other mutations in Alox12e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Alox12e APN 11 70321054 missense probably benign
IGL01781:Alox12e APN 11 70321456 missense probably damaging 1.00
R0284:Alox12e UTSW 11 70320899 splice site probably benign
R0417:Alox12e UTSW 11 70321865 missense probably benign 0.12
R0557:Alox12e UTSW 11 70321448 missense possibly damaging 0.80
R0593:Alox12e UTSW 11 70320897 splice site probably benign
R1479:Alox12e UTSW 11 70320782 missense probably benign 0.04
R1967:Alox12e UTSW 11 70317856 missense probably benign 0.18
R1996:Alox12e UTSW 11 70316208 missense probably benign 0.00
R2062:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2063:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2067:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2068:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2147:Alox12e UTSW 11 70319945 missense probably damaging 1.00
R2307:Alox12e UTSW 11 70321261 missense probably damaging 1.00
R3034:Alox12e UTSW 11 70316253 missense probably benign 0.01
R3739:Alox12e UTSW 11 70319842 missense probably damaging 1.00
R4572:Alox12e UTSW 11 70321181 intron probably benign
R5004:Alox12e UTSW 11 70321504 missense probably benign 0.00
R5113:Alox12e UTSW 11 70315995 missense possibly damaging 0.70
R5155:Alox12e UTSW 11 70316255 missense possibly damaging 0.61
R5464:Alox12e UTSW 11 70317679 missense probably damaging 0.99
R5471:Alox12e UTSW 11 70320024 missense probably benign 0.17
R5501:Alox12e UTSW 11 70316229 missense probably benign 0.01
R5915:Alox12e UTSW 11 70318224 missense possibly damaging 0.81
R6033:Alox12e UTSW 11 70316013 missense probably benign 0.03
R6033:Alox12e UTSW 11 70316013 missense probably benign 0.03
R6102:Alox12e UTSW 11 70320023 missense possibly damaging 0.65
R6380:Alox12e UTSW 11 70321101 missense probably benign 0.00
R6452:Alox12e UTSW 11 70320005 missense probably damaging 0.96
R7175:Alox12e UTSW 11 70319708 missense probably damaging 1.00
R7220:Alox12e UTSW 11 70315905 missense probably benign 0.02
R7353:Alox12e UTSW 11 70321435 missense probably damaging 1.00
R7542:Alox12e UTSW 11 70321756 missense possibly damaging 0.69
R7916:Alox12e UTSW 11 70321285 missense probably benign
R8314:Alox12e UTSW 11 70316172 missense possibly damaging 0.83
R8331:Alox12e UTSW 11 70321097 missense probably benign 0.01
R9027:Alox12e UTSW 11 70321774 missense possibly damaging 0.68
R9380:Alox12e UTSW 11 70316168 critical splice donor site probably null
R9641:Alox12e UTSW 11 70321435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCATTCAAGTATGAGGCG -3'
(R):5'- TGCTGGAATTACGATAGCAAACAC -3'

Sequencing Primer
(F):5'- CCTCCCGTGTAGAGCTGAGTTTG -3'
(R):5'- TACGATAGCAAACACAAAATTATGC -3'
Posted On 2016-04-20