Incidental Mutation 'R4450:Acsl6'
ID381247
Institutional Source Beutler Lab
Gene Symbol Acsl6
Ensembl Gene ENSMUSG00000020333
Gene Nameacyl-CoA synthetase long-chain family member 6
SynonymsLacsl, Facl6, A330035H04Rik
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R4450 (G1)
Quality Score146
Status Validated
Chromosome11
Chromosomal Location54303798-54364756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54328403 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 278 (D278G)
Ref Sequence ENSEMBL: ENSMUSP00000104533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000145] [ENSMUST00000064690] [ENSMUST00000072178] [ENSMUST00000093106] [ENSMUST00000094194] [ENSMUST00000101211] [ENSMUST00000101213] [ENSMUST00000108899] [ENSMUST00000108904] [ENSMUST00000108905] [ENSMUST00000138515] [ENSMUST00000149403] [ENSMUST00000156252]
Predicted Effect probably benign
Transcript: ENSMUST00000000145
AA Change: D218G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000000145
Gene: ENSMUSG00000020333
AA Change: D218G

DomainStartEndE-ValueType
Pfam:AMP-binding 68 273 7.7e-39 PFAM
Pfam:AMP-binding 262 488 2.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064690
AA Change: D253G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000069844
Gene: ENSMUSG00000020333
AA Change: D253G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 102 346 5.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072178
AA Change: D253G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072040
Gene: ENSMUSG00000020333
AA Change: D253G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093106
AA Change: D253G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090795
Gene: ENSMUSG00000020333
AA Change: D253G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094194
AA Change: D253G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091746
Gene: ENSMUSG00000020333
AA Change: D253G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101211
AA Change: D253G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098771
Gene: ENSMUSG00000020333
AA Change: D253G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101213
AA Change: D253G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098773
Gene: ENSMUSG00000020333
AA Change: D253G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108899
AA Change: D253G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104527
Gene: ENSMUSG00000020333
AA Change: D253G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 409 2.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108904
AA Change: D278G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104532
Gene: ENSMUSG00000020333
AA Change: D278G

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 1.6e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108905
AA Change: D278G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104533
Gene: ENSMUSG00000020333
AA Change: D278G

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 7.7e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138515
SMART Domains Protein: ENSMUSP00000117128
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 101 192 5.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149403
SMART Domains Protein: ENSMUSP00000120540
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SCOP:d1lci__ 82 139 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156252
AA Change: D218G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119714
Gene: ENSMUSG00000020333
AA Change: D218G

DomainStartEndE-ValueType
Pfam:AMP-binding 67 363 4.9e-54 PFAM
Meta Mutation Damage Score 0.0973 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of acyl-CoA from fatty acids, ATP, and CoA, using magnesium as a cofactor. The encoded protein plays a major role in fatty acid metabolism in the brain. Translocations with the ETV6 gene are causes of myelodysplastic syndrome with basophilia, acute myelogenous leukemia with eosinophilia, and acute eosinophilic leukemia. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Acsl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Acsl6 APN 11 54325646 missense probably damaging 1.00
IGL01374:Acsl6 APN 11 54338419 missense probably damaging 1.00
IGL01455:Acsl6 APN 11 54323305 missense possibly damaging 0.93
IGL01607:Acsl6 APN 11 54352997 missense possibly damaging 0.94
IGL01731:Acsl6 APN 11 54350559 missense probably benign 0.04
IGL01775:Acsl6 APN 11 54346000 splice site probably benign
IGL02487:Acsl6 APN 11 54336943 missense possibly damaging 0.76
IGL02716:Acsl6 APN 11 54327276 missense probably benign 0.02
IGL02893:Acsl6 APN 11 54345899 missense probably damaging 1.00
R0514:Acsl6 UTSW 11 54350580 missense probably damaging 1.00
R0739:Acsl6 UTSW 11 54337135 missense probably damaging 1.00
R1593:Acsl6 UTSW 11 54323308 missense probably damaging 1.00
R1611:Acsl6 UTSW 11 54325564 missense possibly damaging 0.93
R1626:Acsl6 UTSW 11 54352046 missense probably damaging 1.00
R1633:Acsl6 UTSW 11 54328398 splice site probably benign
R1697:Acsl6 UTSW 11 54329966 missense probably damaging 1.00
R1852:Acsl6 UTSW 11 54361076 missense probably damaging 1.00
R1923:Acsl6 UTSW 11 54325591 missense probably damaging 1.00
R2081:Acsl6 UTSW 11 54320259 missense possibly damaging 0.76
R2144:Acsl6 UTSW 11 54341778 missense probably damaging 1.00
R2167:Acsl6 UTSW 11 54327157 missense probably benign 0.03
R2205:Acsl6 UTSW 11 54324007 missense probably damaging 1.00
R2357:Acsl6 UTSW 11 54327280 missense probably damaging 0.99
R4288:Acsl6 UTSW 11 54337086 missense probably benign 0.19
R4783:Acsl6 UTSW 11 54336993 missense probably damaging 1.00
R5115:Acsl6 UTSW 11 54340498 unclassified probably null
R5233:Acsl6 UTSW 11 54325606 missense possibly damaging 0.69
R5416:Acsl6 UTSW 11 54337171 missense probably benign 0.00
R5482:Acsl6 UTSW 11 54327138 missense probably damaging 1.00
R5633:Acsl6 UTSW 11 54337189 missense probably benign
R5749:Acsl6 UTSW 11 54324055 critical splice donor site probably null
R6139:Acsl6 UTSW 11 54340542 missense probably damaging 1.00
R6270:Acsl6 UTSW 11 54352107 missense probably benign 0.45
R6337:Acsl6 UTSW 11 54340542 missense probably damaging 1.00
R6571:Acsl6 UTSW 11 54325564 missense possibly damaging 0.85
R6736:Acsl6 UTSW 11 54325166 missense probably damaging 1.00
R6918:Acsl6 UTSW 11 54341756 splice site probably null
R6919:Acsl6 UTSW 11 54341756 splice site probably null
R7846:Acsl6 UTSW 11 54361075 missense probably damaging 0.98
R7910:Acsl6 UTSW 11 54345971 nonsense probably null
R7929:Acsl6 UTSW 11 54361075 missense probably damaging 0.98
R7991:Acsl6 UTSW 11 54345971 nonsense probably null
Z1177:Acsl6 UTSW 11 54320172 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTAGGCTAGACTGCATCTGAG -3'
(R):5'- ACAGCAATGTTGGGCAGCTG -3'

Sequencing Primer
(F):5'- CTAGACTGCATCTGAGGAGGG -3'
(R):5'- CTCCGAGGCTGCATACAAG -3'
Posted On2016-04-22