Mutagenetix > Incidental Mutations

Incidental Mutation 'R4557:Snx18'

381250

Institutional Source

Beutler Lab

Gene Symbol

Snx18

Ensembl Gene

ENSMUSG00000042364

Gene Name

sorting nexin 18

Synonyms

Snag1

MMRRC Submission

041784-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.171) question?

Stock #

R4557 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

113592179-113618564 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113617828 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 190 (S190P)

Ref Sequence

ENSEMBL: ENSMUSP00000104864 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109241]

Predicted Effect

probably damaging
Transcript: ENSMUST00000109241
AA Change: S190P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000104864
Gene: ENSMUSG00000042364
AA Change: S190P

Domain	Start	End	E-Value	Type
SH3	3	60	1.04e-14	SMART
low complexity region	61	76	N/A	INTRINSIC
low complexity region	82	105	N/A	INTRINSIC
low complexity region	112	123	N/A	INTRINSIC
low complexity region	141	153	N/A	INTRINSIC
low complexity region	172	182	N/A	INTRINSIC
PX	264	373	8.75e-22	SMART
Pfam:BAR_3_WASP_bdg	377	613	7.1e-111	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223993

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224883

Meta Mutation Damage Score

0.0648

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members, but contains a SH3 domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830005F24Rik	T	C	13: 48,514,461		probably benign	Het
Acad11	T	C	9: 104,082,839	F219L	probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Adamts17	A	T	7: 67,027,893	E518D	probably damaging	Het
Adamts3	A	G	5: 89,700,487	Y659H	probably benign	Het
Adgrb3	T	C	1: 25,084,279	R1414G	probably damaging	Het
Apba1	T	A	19: 23,917,592	I464N	probably damaging	Het
Bahcc1	A	G	11: 120,275,088	T1057A	probably damaging	Het
Bcl11a	A	G	11: 24,164,004	E449G	probably damaging	Het
Ccdc162	T	A	10: 41,587,388	I1453L	probably benign	Het
Ccdc175	T	A	12: 72,128,306	E531V	probably benign	Het
Cep68	A	T	11: 20,239,113		probably benign	Het
Dlgap1	C	A	17: 70,516,689	T223K	probably benign	Het
Exoc1	G	A	5: 76,561,443	V24M	probably damaging	Het
Fbxo4	A	G	15: 3,965,705	*386R	probably null	Het
Gm10100	G	A	10: 77,726,531		probably benign	Het
Gpr149	A	G	3: 62,530,870	V622A	probably damaging	Het
Gpr149	A	C	3: 62,604,497	M27R	probably benign	Het
Ighv3-6	T	C	12: 114,288,198	N101D	probably benign	Het
Igkv4-78	A	G	6: 69,059,771	S93P	possibly damaging	Het
Kmt2c	A	T	5: 25,300,315	W3332R	probably damaging	Het
Marf1	T	C	16: 14,153,977		probably benign	Het
Mcrs1	A	G	15: 99,243,147	I459T	probably benign	Het
Mdn1	G	T	4: 32,754,437	C4646F	probably damaging	Het
Med17	T	C	9: 15,271,697	K351E	possibly damaging	Het
Nalcn	T	C	14: 123,321,235		probably benign	Het
Olfr389	G	A	11: 73,776,481	T282I	possibly damaging	Het
Olfr398	A	T	11: 73,984,599	V3E	probably benign	Het
Olfr761	C	A	17: 37,952,251	A258S	probably benign	Het
Olfr816	A	G	10: 129,911,529	Y250H	probably damaging	Het
Phrf1	C	T	7: 141,258,929		probably benign	Het
Pitpnm1	A	G	19: 4,103,085	Q135R	probably benign	Het
Prdm16	T	A	4: 154,528,827	M48L	probably benign	Het
Ptpn13	A	G	5: 103,541,110	E923G	probably damaging	Het
Rp1	A	T	1: 4,344,663	S2075R	possibly damaging	Het
Sft2d2	A	G	1: 165,183,984	C114R	probably damaging	Het
Sipa1l2	T	G	8: 125,464,415	R945S	probably damaging	Het
Slc12a1	A	G	2: 125,186,641	N517S	probably damaging	Het
Slc44a2	T	G	9: 21,346,783	L443R	possibly damaging	Het
Smok4a	T	C	17: 13,526,381		noncoding transcript	Het
Thap12	A	G	7: 98,715,845	N407D	probably benign	Het
Tmc5	T	C	7: 118,670,733	I902T	probably benign	Het
Ttc27	T	G	17: 74,829,549	S584A	probably benign	Het
Ttn	A	T	2: 76,949,015	Y1174N	probably damaging	Het
Zbtb44	T	G	9: 31,064,248	S391R	probably damaging	Het

Other mutations in Snx18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01756:Snx18	APN	13	113617516	missense	probably benign	0.13
IGL02068:Snx18	APN	13	113617065	missense	probably damaging	1.00
IGL02195:Snx18	APN	13	113616840	missense	probably damaging	0.99
IGL02541:Snx18	APN	13	113594766	missense	probably damaging	0.98
R2419:Snx18	UTSW	13	113617219	missense	possibly damaging	0.52
R2958:Snx18	UTSW	13	113616886	nonsense	probably null
R3010:Snx18	UTSW	13	113616886	nonsense	probably null
R3011:Snx18	UTSW	13	113616886	nonsense	probably null
R4461:Snx18	UTSW	13	113617195	missense	probably damaging	1.00
R4732:Snx18	UTSW	13	113617774	missense	probably benign	0.04
R4733:Snx18	UTSW	13	113617774	missense	probably benign	0.04
R5308:Snx18	UTSW	13	113616847	nonsense	probably null
R6157:Snx18	UTSW	13	113617189	missense	probably damaging	1.00
R6995:Snx18	UTSW	13	113594729	missense	probably damaging	0.99
R8092:Snx18	UTSW	13	113617149	missense	probably damaging	1.00
R8253:Snx18	UTSW	13	113594781	missense	probably damaging	1.00
Z1177:Snx18	UTSW	13	113618145	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TCATGCCCTTGAACTTGGTC -3'
(R):5'- AGCAGCTCTACGGTGGATAC -3'

Sequencing Primer
(F):5'- CGTCGATGGTGCACTGGAAG -3'
(R):5'- TGGATACCAGGCCAGCC -3'

Posted On

2016-04-22