Mutagenetix > Incidental Mutation

Incidental Mutation 'R4565:Sp110'

381251

Institutional Source

Beutler Lab

Gene Symbol

Sp110

Ensembl Gene

ENSMUSG00000070034

Gene Name

Sp110 nuclear body protein

Synonyms

5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa

MMRRC Submission

041790-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.477) question?

Stock #

R4565 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

85576899-85598817 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 85589118 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 219 (E219D)

Ref Sequence

ENSEMBL: ENSMUSP00000091226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093508]

AlphaFold

Q8BVK9

PDB Structure

Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000093508
AA Change: E219D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: E219D

Domain	Start	End	E-Value	Type
Pfam:Sp100	8	106	2.3e-41	PFAM
low complexity region	242	254	N/A	INTRINSIC
low complexity region	259	269	N/A	INTRINSIC
SAND	360	433	3.55e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128339

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131950

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186740

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

97% (37/38)

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930011G23Rik	T	C	5: 99,227,947		probably benign	Het
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Afg3l1	A	T	8: 123,501,869	K725*	probably null	Het
Alkbh1	T	C	12: 87,431,466	D225G	probably damaging	Het
Anxa2	A	T	9: 69,489,737	K241M	probably damaging	Het
Bptf	G	A	11: 107,073,010	T1786M	probably damaging	Het
Cnst	A	G	1: 179,604,549	E208G	probably damaging	Het
Dcdc2b	T	C	4: 129,610,985	T118A	probably benign	Het
Dhx35	C	A	2: 158,849,535	A646E	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dnhd1	T	A	7: 105,651,956	D173E	possibly damaging	Het
Dpy19l1	A	T	9: 24,432,388	L487Q	probably null	Het
Gtse1	T	G	15: 85,875,184	V631G	probably damaging	Het
Haspin	G	A	11: 73,137,619	L215F	probably benign	Het
Herc2	T	C	7: 56,153,838	V2207A	possibly damaging	Het
Jph1	A	G	1: 17,004,202	Y531H	possibly damaging	Het
Limk2	A	G	11: 3,348,634	I261T	probably damaging	Het
Oas3	A	G	5: 120,771,039	F281L	probably damaging	Het
Olfr19	C	A	16: 16,673,693	G96V	probably damaging	Het
Olfr447	A	T	6: 42,911,538	Q5L	probably benign	Het
Pcdhb17	A	G	18: 37,486,470	T438A	probably benign	Het
Pfdn5	T	C	15: 102,326,785		probably benign	Het
Rab11fip3	A	G	17: 26,068,706	C158R	possibly damaging	Het
Rbmxl1	G	A	8: 78,506,010	P235S	probably benign	Het
Slc9b1	G	T	3: 135,382,717	V280F	probably damaging	Het
Trpm3	T	C	19: 22,987,869	I1576T	probably benign	Het
Trpm6	T	A	19: 18,825,872	V893D	probably damaging	Het
Ttc13	A	T	8: 124,682,087	N583K	probably damaging	Het
Zfp618	T	C	4: 63,121,351	C396R	probably damaging	Het

Other mutations in Sp110

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Sp110	APN	1	85577329	missense	probably benign
IGL00510:Sp110	APN	1	85577329	missense	probably benign
IGL00516:Sp110	APN	1	85577329	missense	probably benign
IGL00990:Sp110	APN	1	85586281	missense	possibly damaging	0.51
IGL03382:Sp110	APN	1	85577329	missense	probably benign
FR4342:Sp110	UTSW	1	85587488	small insertion	probably benign
FR4976:Sp110	UTSW	1	85587489	small insertion	probably benign
IGL03147:Sp110	UTSW	1	85591567	frame shift	probably null
PIT4131001:Sp110	UTSW	1	85586250	missense	probably benign	0.05
PIT4131001:Sp110	UTSW	1	85586254	missense	probably benign	0.01
PIT4142001:Sp110	UTSW	1	85586250	missense	probably benign	0.05
PIT4142001:Sp110	UTSW	1	85586254	missense	probably benign	0.01
R0472:Sp110	UTSW	1	85589120	missense	possibly damaging	0.79
R0483:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R0551:Sp110	UTSW	1	85589100	splice site	probably benign
R0638:Sp110	UTSW	1	85577329	missense	probably benign
R0806:Sp110	UTSW	1	85586254	missense	probably benign	0.01
R0806:Sp110	UTSW	1	85586281	missense	possibly damaging	0.51
R1074:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R1079:Sp110	UTSW	1	85589104	splice site	probably benign
R1228:Sp110	UTSW	1	85591760	missense	probably benign	0.03
R1403:Sp110	UTSW	1	85579079	missense	probably benign	0.00
R1406:Sp110	UTSW	1	85579079	missense	probably benign	0.00
R1418:Sp110	UTSW	1	85594385	missense	probably benign	0.08
R1718:Sp110	UTSW	1	85594385	missense	probably benign	0.08
R1744:Sp110	UTSW	1	85594372	missense	probably benign	0.26
R1747:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R1806:Sp110	UTSW	1	85596110	critical splice acceptor site	probably null
R1957:Sp110	UTSW	1	85577329	missense	probably benign
R2404:Sp110	UTSW	1	85577329	missense	probably benign
R2964:Sp110	UTSW	1	85577329	missense	probably benign
R3176:Sp110	UTSW	1	85577329	missense	probably benign
R4190:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R4398:Sp110	UTSW	1	85577329	missense	probably benign
R4505:Sp110	UTSW	1	85589173	missense	probably damaging	1.00
R4625:Sp110	UTSW	1	85577329	missense	probably benign
R4922:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R4986:Sp110	UTSW	1	85591760	missense	probably benign	0.03
R5014:Sp110	UTSW	1	85577329	missense	probably benign
R5080:Sp110	UTSW	1	85596055	nonsense	probably null
R5087:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5254:Sp110	UTSW	1	85577202	utr 3 prime	probably benign
R5335:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5353:Sp110	UTSW	1	85589120	missense	possibly damaging	0.79
R5383:Sp110	UTSW	1	85591569	frame shift	probably null
R5387:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5389:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5398:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5443:Sp110	UTSW	1	85589120	missense	possibly damaging	0.79
R5447:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5729:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5752:Sp110	UTSW	1	85577202	utr 3 prime	probably benign
R5754:Sp110	UTSW	1	85577202	utr 3 prime	probably benign
R5799:Sp110	UTSW	1	85577329	missense	probably benign
R6027:Sp110	UTSW	1	85577318	missense	possibly damaging	0.83
R6171:Sp110	UTSW	1	85577329	missense	probably benign
R6367:Sp110	UTSW	1	85594292	missense	probably benign	0.00
R6771:Sp110	UTSW	1	85592279	splice site	probably null
R7097:Sp110	UTSW	1	85579685	missense	possibly damaging	0.80
R7519:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7520:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7594:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7596:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7598:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7600:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7601:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7602:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7640:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7641:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7674:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7691:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7695:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R8072:Sp110	UTSW	1	85587486	small insertion	probably benign
R8794:Sp110	UTSW	1	85583510	critical splice donor site	probably null
R9284:Sp110	UTSW	1	85579642	critical splice donor site	probably null
R9350:Sp110	UTSW	1	85579092	missense	probably benign	0.01
X0035:Sp110	UTSW	1	85586254	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGCTATCCCAAGCAAGGTTG -3'
(R):5'- TGCCTTCCTTACTGGTTAGAATCA -3'

Sequencing Primer
(F):5'- GTTGCTAAGAGTTAAGTCAGCC -3'
(R):5'- GGTTAGAATCACTGTTCTCTTTACTG -3'

Posted On

2016-04-25