Incidental Mutation 'R4570:Scmh1'
ID381260
Institutional Source Beutler Lab
Gene Symbol Scmh1
Ensembl Gene ENSMUSG00000000085
Gene Namesex comb on midleg homolog 1
SynonymsScml3
MMRRC Submission 041794-MU
Accession Numbers

Ncbi RefSeq: NM_013883.2, NM_001159630.1; MGI:1352762

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4570 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location120405281-120530186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120528298 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 623 (H623Q)
Ref Sequence ENSEMBL: ENSMUSP00000101908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000087] [ENSMUST00000062990] [ENSMUST00000064991] [ENSMUST00000106298] [ENSMUST00000106301]
Predicted Effect probably damaging
Transcript: ENSMUST00000000087
AA Change: H623Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000087
Gene: ENSMUSG00000000085
AA Change: H623Q

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 354 468 4.3e-50 PFAM
SAM 594 662 1.8e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062990
SMART Domains Protein: ENSMUSP00000050896
Gene: ENSMUSG00000047518

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
low complexity region 149 173 N/A INTRINSIC
Pfam:AlbA_2 224 359 2.1e-30 PFAM
coiled coil region 369 401 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064991
AA Change: H623Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069813
Gene: ENSMUSG00000000085
AA Change: H623Q

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 357 465 5.8e-39 PFAM
SAM 594 662 1.57e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106298
AA Change: H623Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101905
Gene: ENSMUSG00000000085
AA Change: H623Q

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 354 468 4.3e-50 PFAM
SAM 594 662 1.8e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106301
AA Change: H623Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101908
Gene: ENSMUSG00000000085
AA Change: H623Q

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 354 468 4.7e-50 PFAM
SAM 594 662 1.57e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144862
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype Strain: 3706668
PHENOTYPE: Mice homozygous for an allele lacking the SPM domain exhibit partial penetrance of posterior vertebral transformations and male infertility with azoospermia and arrest of spermatogenesis. Mice homozygous for a knock-out allele exhibit abnormal hematopoiesis but normal fertility and skeleton. [provided by MGI curators]
Allele List at MGI

All alleles(67) : Targeted(4) Gene trapped(63)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,006,694 D1154G probably damaging Het
Acsl5 T A 19: 55,291,774 I493N probably damaging Het
Adgrf5 T A 17: 43,445,115 S450T probably benign Het
Ak2 T C 4: 129,002,167 V79A probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arfgef2 C A 2: 166,856,538 Q643K probably damaging Het
Asap3 A G 4: 136,240,185 D605G probably damaging Het
BC067074 T A 13: 113,318,191 V257D probably damaging Het
Ccr5 C T 9: 124,124,875 Q172* probably null Het
Cpxm2 T C 7: 132,143,706 D130G probably benign Het
Cxcl12 T C 6: 117,168,672 V6A probably benign Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dpcr1 T C 17: 35,637,991 T239A possibly damaging Het
Dzip1l A T 9: 99,647,168 K317* probably null Het
Edil3 A G 13: 89,131,897 probably benign Het
Enpep A T 3: 129,281,548 I707K possibly damaging Het
Fcrlb A G 1: 170,912,620 probably null Het
Flt1 C T 5: 147,594,613 A847T probably damaging Het
Fsd2 T C 7: 81,559,770 D108G probably benign Het
Gemin6 C T 17: 80,228,069 R153* probably null Het
Gldc T A 19: 30,174,439 M112L probably benign Het
Gm10267 C T 18: 44,156,425 M79I probably benign Het
Gm10803 A G 2: 93,564,252 Y123C unknown Het
Gm28040 C A 1: 133,329,381 probably benign Het
Gm8674 T A 13: 49,902,534 noncoding transcript Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Hba-a2 T C 11: 32,297,200 Y141H probably damaging Het
Hmbox1 T A 14: 64,823,662 I388F possibly damaging Het
Hs6st1 G T 1: 36,103,547 V188L possibly damaging Het
Ipmk T G 10: 71,372,739 H118Q probably benign Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Kcna2 A G 3: 107,104,795 I231V probably benign Het
Kcnh7 T C 2: 62,837,095 T367A possibly damaging Het
Kcp A T 6: 29,491,848 C197* probably null Het
Klra2 C A 6: 131,243,937 C54F probably damaging Het
Lcn9 T C 2: 25,823,579 L39P probably benign Het
Lct T C 1: 128,299,904 N1284S probably benign Het
Map6 T G 7: 99,336,556 S556A possibly damaging Het
Mdn1 C A 4: 32,741,812 T3861K probably damaging Het
Mrps12 A G 7: 28,739,963 L109P probably damaging Het
Mybphl G A 3: 108,365,031 C12Y possibly damaging Het
Nek9 T C 12: 85,320,734 K388E probably damaging Het
Nvl A G 1: 181,144,082 V9A probably benign Het
Obscn T C 11: 59,006,828 probably null Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pik3c3 T A 18: 30,290,550 I233N possibly damaging Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Ppara A G 15: 85,787,197 I100V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Scn9a A G 2: 66,483,558 S1939P possibly damaging Het
Slc6a13 T C 6: 121,336,142 probably null Het
Slc7a4 G A 16: 17,574,277 T431I probably benign Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Spopl T A 2: 23,537,485 K212* probably null Het
Strn T A 17: 78,677,372 T281S possibly damaging Het
Supt3 T A 17: 45,041,229 L265* probably null Het
Taf5l G A 8: 123,997,550 T510M probably damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Tarbp1 A T 8: 126,452,233 D702E probably benign Het
Tfap2c C A 2: 172,557,327 P473Q probably damaging Het
Tnc T C 4: 63,995,672 N1301S probably damaging Het
Trim33 A G 3: 103,330,165 Q179R probably damaging Het
Txnrd2 A G 16: 18,468,804 N335S probably benign Het
Uggt1 T A 1: 36,150,073 D1444V probably damaging Het
Ugt3a2 T C 15: 9,338,721 L57P probably benign Het
Vmn2r6 A T 3: 64,559,647 W144R probably benign Het
Vmn2r98 T A 17: 19,066,092 M284K probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp703 T C 8: 26,978,953 V215A probably benign Het
Other mutations in Scmh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Scmh1 APN 4 120529900 utr 3 prime probably benign
IGL01962:Scmh1 APN 4 120483584 splice site probably benign
IGL02013:Scmh1 APN 4 120483732 missense possibly damaging 0.77
IGL02081:Scmh1 APN 4 120515078 missense probably damaging 1.00
IGL02223:Scmh1 APN 4 120515219 missense probably benign 0.26
IGL02530:Scmh1 APN 4 120528146 splice site probably benign
IGL02887:Scmh1 APN 4 120468389 missense probably damaging 1.00
P0024:Scmh1 UTSW 4 120478034 missense probably damaging 1.00
R0164:Scmh1 UTSW 4 120529865 unclassified probably benign
R0164:Scmh1 UTSW 4 120529865 unclassified probably benign
R0200:Scmh1 UTSW 4 120483831 missense probably damaging 0.99
R1598:Scmh1 UTSW 4 120515130 missense possibly damaging 0.83
R1624:Scmh1 UTSW 4 120529228 missense probably damaging 1.00
R2276:Scmh1 UTSW 4 120483672 missense probably damaging 1.00
R3734:Scmh1 UTSW 4 120478080 missense probably damaging 1.00
R4167:Scmh1 UTSW 4 120529276 intron probably benign
R5458:Scmh1 UTSW 4 120505281 unclassified probably benign
R5564:Scmh1 UTSW 4 120468378 missense probably damaging 1.00
R5700:Scmh1 UTSW 4 120516946 missense probably benign 0.10
R5991:Scmh1 UTSW 4 120522620 missense probably benign
R5999:Scmh1 UTSW 4 120505515 critical splice donor site probably null
R7097:Scmh1 UTSW 4 120525055 missense probably benign
R7432:Scmh1 UTSW 4 120529156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCATTGTGCTAAGTGCC -3'
(R):5'- GACATGGATAAAGCACCCTTGAG -3'

Sequencing Primer
(F):5'- AAGTGCCCTTGTATCCTTCAGGG -3'
(R):5'- CTTGAGAAAGAGATCCCTGTAACCTG -3'
Posted On2016-04-26