Mutagenetix > Incidental Mutations

Incidental Mutation 'R4424:Fanca'

381270

Institutional Source

Beutler Lab

Gene Symbol

Fanca

Ensembl Gene

ENSMUSG00000032815

Gene Name

Fanconi anemia, complementation group A

Synonyms

MMRRC Submission

041696-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.528) question?

Stock #

R4424 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

123268300-123318576 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123288793 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 715 (V715A)

Ref Sequence

ENSEMBL: ENSMUSP00000045217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035495] [ENSMUST00000127664] [ENSMUST00000127904]

Predicted Effect

probably benign
Transcript: ENSMUST00000035495
AA Change: V715A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815
AA Change: V715A

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	78	100	N/A	INTRINSIC
Pfam:Fanconi_A_N	167	520	3.7e-146	PFAM
low complexity region	645	660	N/A	INTRINSIC
low complexity region	778	790	N/A	INTRINSIC
low complexity region	1069	1079	N/A	INTRINSIC
low complexity region	1200	1225	N/A	INTRINSIC
Pfam:Fanconi_A	1246	1308	8.4e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127904
AA Change: V617A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000116614
Gene: ENSMUSG00000032815
AA Change: V617A

Domain	Start	End	E-Value	Type
low complexity region	547	562	N/A	INTRINSIC
low complexity region	680	692	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133950

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155488

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212953

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

95% (69/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	T	2: 68,615,147		probably benign	Het
Aimp1	A	T	3: 132,667,492	L229Q	probably benign	Het
Ankrd16	T	A	2: 11,784,404	D267E	possibly damaging	Het
Apol11b	A	G	15: 77,637,933		probably null	Het
Arfgap1	C	A	2: 180,981,076	D327E	probably benign	Het
Arid3b	A	T	9: 57,833,868	D98E	probably benign	Het
Art2b	T	A	7: 101,579,922	I257F	probably benign	Het
Atp5a1	T	A	18: 77,780,066		probably benign	Het
Carmil3	A	G	14: 55,501,471	T861A	probably benign	Het
Cep164	A	T	9: 45,779,704	F1259L	possibly damaging	Het
Chrnd	T	C	1: 87,195,790	V350A	probably benign	Het
Clcn7	T	C	17: 25,160,176	L744P	probably damaging	Het
Csl	T	A	10: 99,758,591	D204V	possibly damaging	Het
Cyp2c29	G	T	19: 39,287,176	W20L	probably damaging	Het
Dhrs13	G	T	11: 78,037,125	G266*	probably null	Het
Dll3	T	C	7: 28,296,291	N362D	probably damaging	Het
Fhod1	T	C	8: 105,337,351		probably benign	Het
Fpr2	C	T	17: 17,893,132	P130L	probably damaging	Het
Glce	A	G	9: 62,060,253	Y539H	probably damaging	Het
Gm11639	T	G	11: 104,736,114		probably null	Het
Gm4758	A	G	16: 36,312,589	D76G	probably null	Het
Hfe	A	T	13: 23,706,883	V91E	probably benign	Het
Hoxd13	A	T	2: 74,669,957	K281*	probably null	Het
Ighv1-66	A	T	12: 115,593,537	W3R	probably damaging	Het
Impg2	G	A	16: 56,260,025	V622I	possibly damaging	Het
Jun	A	G	4: 95,050,847	M142T	probably benign	Het
Krt78	T	C	15: 101,947,940	T479A	probably benign	Het
Lama3	T	A	18: 12,519,872	C216*	probably null	Het
Lin54	G	T	5: 100,446,560	T582K	probably damaging	Het
Maats1	G	T	16: 38,320,365	P409T	probably damaging	Het
Mapk11	A	G	15: 89,145,373		probably null	Het
Mindy3	A	G	2: 12,348,199	M397T	probably benign	Het
Mrpl41	T	C	2: 24,974,406	T85A	possibly damaging	Het
Msh6	T	A	17: 87,990,789	L1354*	probably null	Het
Mtmr12	T	C	15: 12,230,314	V41A	probably damaging	Het
Myh2	A	T	11: 67,192,725	Q1478L	probably benign	Het
Myo6	A	G	9: 80,288,038	K897E	probably benign	Het
Naprt	G	T	15: 75,892,756		probably null	Het
Nrl	G	A	14: 55,522,218	S84L	probably benign	Het
Nxf1	A	G	19: 8,766,764		probably benign	Het
Olfr971	A	T	9: 39,840,356	R307S	possibly damaging	Het
Panx2	G	T	15: 89,068,220	V305F	probably benign	Het
Pcdhga1	T	C	18: 37,662,579	L212P	probably damaging	Het
Pik3ap1	G	A	19: 41,375,881	T133I	probably benign	Het
Ppat	A	G	5: 76,915,214	W517R	probably damaging	Het
Ppp1r16b	C	T	2: 158,757,254	T382I	probably benign	Het
Prkdc	A	G	16: 15,773,739	K2694E	probably damaging	Het
Prkdc	G	A	16: 15,836,082	R3901H	probably damaging	Het
Psma8	A	G	18: 14,721,190	I42M	probably damaging	Het
Ptprd	A	T	4: 76,102,963	M599K	probably benign	Het
Rnmt	A	G	18: 68,311,671	D237G	probably null	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Scaf11	G	A	15: 96,418,428	T1085I	possibly damaging	Het
Sec14l3	G	A	11: 4,066,210	R43Q	probably damaging	Het
Shc4	G	T	2: 125,652,522	T131K	probably benign	Het
Snx27	A	G	3: 94,562,023	F4L	probably benign	Het
Sorcs1	T	C	19: 50,378,941	T228A	probably damaging	Het
Sptan1	C	T	2: 30,029,709		probably benign	Het
Syvn1	C	T	19: 6,049,921		probably benign	Het
Tex47	G	T	5: 7,305,364	A182S	probably benign	Het
Thegl	T	C	5: 77,054,536	I268T	possibly damaging	Het
Tpcn1	T	C	5: 120,542,518	K549R	probably damaging	Het
Upf3a	C	A	8: 13,796,573	P318T	probably benign	Het
Zbtb40	A	T	4: 136,998,694	M518K	probably damaging	Het
Zcchc14	G	A	8: 121,651,941		probably benign	Het
Zfp687	G	A	3: 95,009,128	P861L	probably damaging	Het

Other mutations in Fanca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02348:Fanca	APN	8	123305263	missense	probably damaging	1.00
IGL02805:Fanca	APN	8	123289494	missense	probably damaging	0.99
IGL03280:Fanca	APN	8	123316459	unclassified	probably benign
PIT4402001:Fanca	UTSW	8	123313064	missense	possibly damaging	0.83
R0114:Fanca	UTSW	8	123288491	splice site	probably null
R0115:Fanca	UTSW	8	123268539	missense	probably benign	0.00
R0271:Fanca	UTSW	8	123272441	unclassified	probably benign
R0330:Fanca	UTSW	8	123274172	nonsense	probably null
R0345:Fanca	UTSW	8	123304813	missense	probably damaging	1.00
R0570:Fanca	UTSW	8	123306430	missense	probably benign	0.01
R0601:Fanca	UTSW	8	123308513	missense	probably damaging	0.99
R0617:Fanca	UTSW	8	123288070	missense	probably damaging	0.99
R0639:Fanca	UTSW	8	123289359	critical splice donor site	probably null
R0943:Fanca	UTSW	8	123274186	missense	probably damaging	1.00
R1140:Fanca	UTSW	8	123313129	splice site	probably null
R1364:Fanca	UTSW	8	123304281	splice site	probably benign
R1366:Fanca	UTSW	8	123304281	splice site	probably benign
R1367:Fanca	UTSW	8	123304281	splice site	probably benign
R1368:Fanca	UTSW	8	123304281	splice site	probably benign
R1969:Fanca	UTSW	8	123288064	missense	probably benign	0.41
R1992:Fanca	UTSW	8	123297812	missense	possibly damaging	0.94
R2060:Fanca	UTSW	8	123274481	missense	probably damaging	1.00
R2174:Fanca	UTSW	8	123271270	missense	probably benign	0.00
R2261:Fanca	UTSW	8	123289359	critical splice donor site	probably null
R3957:Fanca	UTSW	8	123316363	missense	probably benign	0.00
R4062:Fanca	UTSW	8	123275172	missense	probably benign	0.00
R4153:Fanca	UTSW	8	123304878	missense	possibly damaging	0.89
R4270:Fanca	UTSW	8	123268794	missense	probably damaging	1.00
R4581:Fanca	UTSW	8	123274338	splice site	probably null
R4639:Fanca	UTSW	8	123318150	missense	probably damaging	0.98
R4664:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4665:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4666:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4686:Fanca	UTSW	8	123268934	splice site	probably benign
R4775:Fanca	UTSW	8	123296306	missense	probably damaging	0.99
R4782:Fanca	UTSW	8	123288202	missense	probably damaging	1.00
R4799:Fanca	UTSW	8	123288202	missense	probably damaging	1.00
R4926:Fanca	UTSW	8	123303985	missense	probably benign	0.05
R4973:Fanca	UTSW	8	123308522	missense	probably damaging	0.96
R5039:Fanca	UTSW	8	123284046	missense	probably benign
R5195:Fanca	UTSW	8	123303945	intron	probably benign
R5590:Fanca	UTSW	8	123303963	intron	probably benign
R5848:Fanca	UTSW	8	123295053	intron	probably benign
R5965:Fanca	UTSW	8	123316410	missense	possibly damaging	0.46
R6224:Fanca	UTSW	8	123305281	missense	possibly damaging	0.87
R6385:Fanca	UTSW	8	123305867	splice site	probably null
R6762:Fanca	UTSW	8	123271303	missense	probably benign	0.26
R6795:Fanca	UTSW	8	123318493	missense	probably benign	0.02
R6810:Fanca	UTSW	8	123286477	missense	probably damaging	0.99
R7153:Fanca	UTSW	8	123316425	missense	probably damaging	1.00
R7170:Fanca	UTSW	8	123271206	missense	probably damaging	1.00
R7204:Fanca	UTSW	8	123286477	missense	probably damaging	0.98
R7366:Fanca	UTSW	8	123281213	missense	probably benign	0.08
R7599:Fanca	UTSW	8	123271260	missense	probably benign
R7639:Fanca	UTSW	8	123291395	critical splice donor site	probably null
R7650:Fanca	UTSW	8	123268564	splice site	probably null
R8066:Fanca	UTSW	8	123303940	missense	unknown
R8247:Fanca	UTSW	8	123283955	unclassified	probably benign
R8312:Fanca	UTSW	8	123269810	intron	probably benign
R8327:Fanca	UTSW	8	123313245	nonsense	probably null
V7732:Fanca	UTSW	8	123304281	splice site	probably benign
X0025:Fanca	UTSW	8	123276548	intron	probably benign
X0062:Fanca	UTSW	8	123304852	missense	possibly damaging	0.95
Z1177:Fanca	UTSW	8	123312629	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGCATCCCTAGCTGACAAG -3'
(R):5'- TGGTACCAACTTGCAATGTAAC -3'

Sequencing Primer
(F):5'- ACAAGCTCGGCCTCGTCATC -3'
(R):5'- AGCCTGACAGCCTGAGTTTGATC -3'

Posted On

2016-04-27