Incidental Mutation 'R4424:Fanca'
ID381270
Institutional Source Beutler Lab
Gene Symbol Fanca
Ensembl Gene ENSMUSG00000032815
Gene NameFanconi anemia, complementation group A
Synonyms
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R4424 (G1)
Quality Score204
Status Validated
Chromosome8
Chromosomal Location123268300-123318576 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123288793 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 715 (V715A)
Ref Sequence ENSEMBL: ENSMUSP00000045217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035495] [ENSMUST00000127664] [ENSMUST00000127904]
Predicted Effect probably benign
Transcript: ENSMUST00000035495
AA Change: V715A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815
AA Change: V715A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127904
AA Change: V617A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116614
Gene: ENSMUSG00000032815
AA Change: V617A

DomainStartEndE-ValueType
low complexity region 547 562 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212953
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arid3b A T 9: 57,833,868 D98E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Cep164 A T 9: 45,779,704 F1259L possibly damaging Het
Chrnd T C 1: 87,195,790 V350A probably benign Het
Clcn7 T C 17: 25,160,176 L744P probably damaging Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dhrs13 G T 11: 78,037,125 G266* probably null Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Impg2 G A 16: 56,260,025 V622I possibly damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Lin54 G T 5: 100,446,560 T582K probably damaging Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mapk11 A G 15: 89,145,373 probably null Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Mrpl41 T C 2: 24,974,406 T85A possibly damaging Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Nxf1 A G 19: 8,766,764 probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pcdhga1 T C 18: 37,662,579 L212P probably damaging Het
Pik3ap1 G A 19: 41,375,881 T133I probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Zfp687 G A 3: 95,009,128 P861L probably damaging Het
Other mutations in Fanca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02348:Fanca APN 8 123305263 missense probably damaging 1.00
IGL02805:Fanca APN 8 123289494 missense probably damaging 0.99
IGL03280:Fanca APN 8 123316459 unclassified probably benign
PIT4402001:Fanca UTSW 8 123313064 missense possibly damaging 0.83
R0114:Fanca UTSW 8 123288491 splice site probably null
R0115:Fanca UTSW 8 123268539 missense probably benign 0.00
R0271:Fanca UTSW 8 123272441 unclassified probably benign
R0330:Fanca UTSW 8 123274172 nonsense probably null
R0345:Fanca UTSW 8 123304813 missense probably damaging 1.00
R0570:Fanca UTSW 8 123306430 missense probably benign 0.01
R0601:Fanca UTSW 8 123308513 missense probably damaging 0.99
R0617:Fanca UTSW 8 123288070 missense probably damaging 0.99
R0639:Fanca UTSW 8 123289359 critical splice donor site probably null
R0943:Fanca UTSW 8 123274186 missense probably damaging 1.00
R1140:Fanca UTSW 8 123313129 splice site probably null
R1364:Fanca UTSW 8 123304281 splice site probably benign
R1366:Fanca UTSW 8 123304281 splice site probably benign
R1367:Fanca UTSW 8 123304281 splice site probably benign
R1368:Fanca UTSW 8 123304281 splice site probably benign
R1969:Fanca UTSW 8 123288064 missense probably benign 0.41
R1992:Fanca UTSW 8 123297812 missense possibly damaging 0.94
R2060:Fanca UTSW 8 123274481 missense probably damaging 1.00
R2174:Fanca UTSW 8 123271270 missense probably benign 0.00
R2261:Fanca UTSW 8 123289359 critical splice donor site probably null
R3957:Fanca UTSW 8 123316363 missense probably benign 0.00
R4062:Fanca UTSW 8 123275172 missense probably benign 0.00
R4153:Fanca UTSW 8 123304878 missense possibly damaging 0.89
R4270:Fanca UTSW 8 123268794 missense probably damaging 1.00
R4581:Fanca UTSW 8 123274338 splice site probably null
R4639:Fanca UTSW 8 123318150 missense probably damaging 0.98
R4664:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4665:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4666:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4686:Fanca UTSW 8 123268934 splice site probably benign
R4775:Fanca UTSW 8 123296306 missense probably damaging 0.99
R4782:Fanca UTSW 8 123288202 missense probably damaging 1.00
R4799:Fanca UTSW 8 123288202 missense probably damaging 1.00
R4926:Fanca UTSW 8 123303985 missense probably benign 0.05
R4973:Fanca UTSW 8 123308522 missense probably damaging 0.96
R5039:Fanca UTSW 8 123284046 missense probably benign
R5195:Fanca UTSW 8 123303945 intron probably benign
R5590:Fanca UTSW 8 123303963 intron probably benign
R5848:Fanca UTSW 8 123295053 intron probably benign
R5965:Fanca UTSW 8 123316410 missense possibly damaging 0.46
R6224:Fanca UTSW 8 123305281 missense possibly damaging 0.87
R6385:Fanca UTSW 8 123305867 splice site probably null
R6762:Fanca UTSW 8 123271303 missense probably benign 0.26
R6795:Fanca UTSW 8 123318493 missense probably benign 0.02
R6810:Fanca UTSW 8 123286477 missense probably damaging 0.99
R7153:Fanca UTSW 8 123316425 missense probably damaging 1.00
R7170:Fanca UTSW 8 123271206 missense probably damaging 1.00
R7204:Fanca UTSW 8 123286477 missense probably damaging 0.98
R7366:Fanca UTSW 8 123281213 missense probably benign 0.08
R7599:Fanca UTSW 8 123271260 missense probably benign
R7639:Fanca UTSW 8 123291395 critical splice donor site probably null
R7650:Fanca UTSW 8 123268564 splice site probably null
R8066:Fanca UTSW 8 123303940 missense unknown
R8247:Fanca UTSW 8 123283955 unclassified probably benign
R8312:Fanca UTSW 8 123269810 intron probably benign
R8327:Fanca UTSW 8 123313245 nonsense probably null
V7732:Fanca UTSW 8 123304281 splice site probably benign
X0025:Fanca UTSW 8 123276548 intron probably benign
X0062:Fanca UTSW 8 123304852 missense possibly damaging 0.95
Z1177:Fanca UTSW 8 123312629 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCATCCCTAGCTGACAAG -3'
(R):5'- TGGTACCAACTTGCAATGTAAC -3'

Sequencing Primer
(F):5'- ACAAGCTCGGCCTCGTCATC -3'
(R):5'- AGCCTGACAGCCTGAGTTTGATC -3'
Posted On2016-04-27