Incidental Mutation 'R4945:Atp1b1'
ID 381275
Institutional Source Beutler Lab
Gene Symbol Atp1b1
Ensembl Gene ENSMUSG00000026576
Gene Name ATPase, Na+/K+ transporting, beta 1 polypeptide
Synonyms Atpb-1, Atpb, sodium/potassium ATPase beta subunit
MMRRC Submission 042542-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.739) question?
Stock # R4945 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 164264678-164285924 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 164265867 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 298 (V298A)
Ref Sequence ENSEMBL: ENSMUSP00000027863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027863] [ENSMUST00000191947] [ENSMUST00000193367] [ENSMUST00000193683] [ENSMUST00000193808]
AlphaFold P14094
Predicted Effect probably damaging
Transcript: ENSMUST00000027863
AA Change: V298A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027863
Gene: ENSMUSG00000026576
AA Change: V298A

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 3 298 1.1e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191947
SMART Domains Protein: ENSMUSP00000141431
Gene: ENSMUSG00000026575

DomainStartEndE-ValueType
DM10 22 110 1.9e-37 SMART
NDK 110 248 1.75e-68 SMART
NDK 256 394 1.11e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192710
Predicted Effect probably benign
Transcript: ENSMUST00000193367
SMART Domains Protein: ENSMUSP00000141777
Gene: ENSMUSG00000026576

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 1 132 2.7e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193591
Predicted Effect probably benign
Transcript: ENSMUST00000193683
SMART Domains Protein: ENSMUSP00000141963
Gene: ENSMUSG00000026575

DomainStartEndE-ValueType
DM10 22 110 1.9e-37 SMART
NDK 110 248 1.75e-68 SMART
NDK 256 394 1.11e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193980
Predicted Effect probably benign
Transcript: ENSMUST00000193808
SMART Domains Protein: ENSMUSP00000141771
Gene: ENSMUSG00000026575

DomainStartEndE-ValueType
DM10 22 110 1.9e-37 SMART
NDK 110 248 1.75e-68 SMART
NDK 256 394 1.11e-43 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that comprises a subunit of an ATP-metabolizing enzyme responsible for transporting sodium and potassium ions across the plasma membrane. This enzyme regulates the electrochemical gradient of these ions in cells, and plays a central role in osmoregulation and signal transmission in nerves and muscles, among other biological processes. The encoded protein is the non-catalytic beta subunit; it works together with a catalytic alpha subunit and a gamma subunit. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac tissue exhibit age-related cardiac hypertrophy and reduced cardiac function, insensitivity to ouabain, and increased heart dysfunction following aortic constriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,876,622 (GRCm39) R512H probably damaging Het
Adgrl2 T A 3: 148,528,672 (GRCm39) M1158L probably damaging Het
Adgrl3 C A 5: 81,659,895 (GRCm39) H153Q probably damaging Het
Aldh1a2 C A 9: 71,123,198 (GRCm39) Q24K probably benign Het
Casp8ap2 T A 4: 32,631,163 (GRCm39) N74K possibly damaging Het
Cep135 A G 5: 76,745,275 (GRCm39) D229G probably benign Het
Cerk C G 15: 86,040,802 (GRCm39) D186H probably benign Het
Cmtr2 T C 8: 110,948,065 (GRCm39) F125S probably damaging Het
Col6a1 A G 10: 76,548,106 (GRCm39) V650A unknown Het
Cuzd1 A G 7: 130,918,350 (GRCm39) F196L probably damaging Het
Esm1 T G 13: 113,346,679 (GRCm39) probably null Het
Fbn2 T A 18: 58,183,325 (GRCm39) I1787F possibly damaging Het
Gm1110 T C 9: 26,831,891 (GRCm39) M87V possibly damaging Het
Gpr179 T C 11: 97,240,544 (GRCm39) H293R probably damaging Het
Grk2 A G 19: 4,340,475 (GRCm39) I302T probably damaging Het
Hoxb6 A G 11: 96,190,085 (GRCm39) Y28C possibly damaging Het
Ift27 A G 15: 78,048,454 (GRCm39) V110A probably damaging Het
Igfbp7 T C 5: 77,499,104 (GRCm39) D267G probably benign Het
Ighv1-49 C A 12: 115,019,028 (GRCm39) V56L possibly damaging Het
Ighv8-8 C T 12: 115,257,881 (GRCm39) M53I probably benign Het
Kcnj3 T A 2: 55,327,590 (GRCm39) N126K probably damaging Het
Kif12 C T 4: 63,086,730 (GRCm39) probably null Het
Lrif1 A C 3: 106,643,069 (GRCm39) I725L probably damaging Het
Lrrk2 T C 15: 91,689,123 (GRCm39) V2265A probably benign Het
Med25 T C 7: 44,532,526 (GRCm39) N438S possibly damaging Het
Mex3b A T 7: 82,519,382 (GRCm39) T566S probably benign Het
Mkx T C 18: 7,000,657 (GRCm39) N95S possibly damaging Het
Morc3 A T 16: 93,668,082 (GRCm39) D820V probably damaging Het
Mroh4 G T 15: 74,483,857 (GRCm39) N562K probably benign Het
Ndst3 A T 3: 123,346,201 (GRCm39) I276N probably damaging Het
Notch2 A G 3: 98,019,037 (GRCm39) N733S probably benign Het
Or10a5 A T 7: 106,635,526 (GRCm39) M55L probably benign Het
Or2l13b C A 16: 19,349,307 (GRCm39) R121L probably benign Het
Or51k1 G A 7: 103,661,585 (GRCm39) T108I possibly damaging Het
Or5ak24 T C 2: 85,260,895 (GRCm39) T93A probably benign Het
Or5m13 T A 2: 85,748,917 (GRCm39) I216N possibly damaging Het
Or8b38 G T 9: 37,973,068 (GRCm39) G151C probably damaging Het
Or8b44 A T 9: 38,410,585 (GRCm39) I207F probably damaging Het
Or8k37 T C 2: 86,469,833 (GRCm39) Y73C probably damaging Het
Patj A T 4: 98,383,301 (GRCm39) N268Y probably damaging Het
Pbrm1 T A 14: 30,774,173 (GRCm39) D446E probably damaging Het
Pcdhga11 A G 18: 37,891,085 (GRCm39) T698A probably benign Het
Pde6a T C 18: 61,367,790 (GRCm39) V266A probably damaging Het
Phax G T 18: 56,709,063 (GRCm39) R209L probably damaging Het
Pld2 T A 11: 70,446,524 (GRCm39) M20K probably damaging Het
Rabl3 T C 16: 37,362,220 (GRCm39) S20P probably damaging Het
Rad51 T A 2: 118,957,629 (GRCm39) V174E probably damaging Het
Rb1cc1 A G 1: 6,319,851 (GRCm39) E1090G probably benign Het
Rfc3 T C 5: 151,566,450 (GRCm39) E333G probably damaging Het
Rfx6 T G 10: 51,602,947 (GRCm39) Y821* probably null Het
Riok3 A G 18: 12,261,972 (GRCm39) D2G probably damaging Het
Rtn1 G T 12: 72,264,258 (GRCm39) A183E probably damaging Het
Skint8 T C 4: 111,796,805 (GRCm39) L303P probably damaging Het
Slc36a2 C A 11: 55,065,520 (GRCm39) V162L probably benign Het
Sorcs3 T C 19: 48,752,587 (GRCm39) V794A possibly damaging Het
Sspo A G 6: 48,444,021 (GRCm39) probably null Het
Tbk1 T C 10: 121,387,174 (GRCm39) N707S probably damaging Het
Tchhl1 A T 3: 93,378,883 (GRCm39) H529L probably benign Het
Tgfbr2 A T 9: 115,960,633 (GRCm39) H106Q probably benign Het
Trim8 A G 19: 46,491,214 (GRCm39) E111G probably benign Het
Tshz2 A G 2: 169,725,794 (GRCm39) Y130C probably damaging Het
Txndc15 T A 13: 55,865,978 (GRCm39) D147E probably benign Het
Vmn1r172 T A 7: 23,359,745 (GRCm39) L210H possibly damaging Het
Vmn1r55 A G 7: 5,150,105 (GRCm39) V106A probably damaging Het
Vmn2r49 T A 7: 9,720,214 (GRCm39) K426* probably null Het
Wnk2 C T 13: 49,210,722 (GRCm39) R206Q probably damaging Het
Zfp1007 A T 5: 109,824,941 (GRCm39) C170S possibly damaging Het
Zfp473 T C 7: 44,383,988 (GRCm39) N115S probably benign Het
Zfp536 G T 7: 37,269,161 (GRCm39) A85D probably damaging Het
Zfp853 C A 5: 143,274,584 (GRCm39) Q345H unknown Het
Other mutations in Atp1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Atp1b1 APN 1 164,285,330 (GRCm39) missense probably benign 0.34
IGL01801:Atp1b1 APN 1 164,265,918 (GRCm39) missense probably damaging 1.00
R0941:Atp1b1 UTSW 1 164,270,829 (GRCm39) missense probably benign
R1034:Atp1b1 UTSW 1 164,281,057 (GRCm39) critical splice donor site probably null
R1597:Atp1b1 UTSW 1 164,265,889 (GRCm39) missense probably damaging 1.00
R2202:Atp1b1 UTSW 1 164,281,084 (GRCm39) missense probably benign 0.01
R3811:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R3817:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R3819:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R3880:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R4420:Atp1b1 UTSW 1 164,281,127 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCACTACAAGTCAGTTACGG -3'
(R):5'- GCAGTATTATCCCTACTACGGC -3'

Sequencing Primer
(F):5'- TTACAGTAAAAATGGGCACGTCC -3'
(R):5'- GTATTATCCCTACTACGGCAAACTC -3'
Posted On 2016-04-27