Incidental Mutation 'R4945:Tchhl1'
ID 381284
Institutional Source Beutler Lab
Gene Symbol Tchhl1
Ensembl Gene ENSMUSG00000027908
Gene Name trichohyalin-like 1
Synonyms S100a17, Thhl1
MMRRC Submission 042542-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4945 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 93376061-93379287 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 93378883 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 529 (H529L)
Ref Sequence ENSEMBL: ENSMUSP00000029516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029516]
AlphaFold Q9D3P1
Predicted Effect probably benign
Transcript: ENSMUST00000029516
AA Change: H529L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029516
Gene: ENSMUSG00000027908
AA Change: H529L

DomainStartEndE-ValueType
Pfam:S_100 4 47 1.2e-15 PFAM
low complexity region 111 124 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the S100 fused-type protein (SFTP) gene family, and is located in a cluster of SFTP genes on chromosome 1q21. Several members of this family have been implicated in the development of complex skin disorders. This gene is evolutionarily conserved; its expression appears to be hair-specific and spatially restricted within the distal inner root sheath of the hair follicle. It thus may have an important role in hair morphogenesis. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,876,622 (GRCm39) R512H probably damaging Het
Adgrl2 T A 3: 148,528,672 (GRCm39) M1158L probably damaging Het
Adgrl3 C A 5: 81,659,895 (GRCm39) H153Q probably damaging Het
Aldh1a2 C A 9: 71,123,198 (GRCm39) Q24K probably benign Het
Atp1b1 A G 1: 164,265,867 (GRCm39) V298A probably damaging Het
Casp8ap2 T A 4: 32,631,163 (GRCm39) N74K possibly damaging Het
Cep135 A G 5: 76,745,275 (GRCm39) D229G probably benign Het
Cerk C G 15: 86,040,802 (GRCm39) D186H probably benign Het
Cmtr2 T C 8: 110,948,065 (GRCm39) F125S probably damaging Het
Col6a1 A G 10: 76,548,106 (GRCm39) V650A unknown Het
Cuzd1 A G 7: 130,918,350 (GRCm39) F196L probably damaging Het
Esm1 T G 13: 113,346,679 (GRCm39) probably null Het
Fbn2 T A 18: 58,183,325 (GRCm39) I1787F possibly damaging Het
Gm1110 T C 9: 26,831,891 (GRCm39) M87V possibly damaging Het
Gpr179 T C 11: 97,240,544 (GRCm39) H293R probably damaging Het
Grk2 A G 19: 4,340,475 (GRCm39) I302T probably damaging Het
Hoxb6 A G 11: 96,190,085 (GRCm39) Y28C possibly damaging Het
Ift27 A G 15: 78,048,454 (GRCm39) V110A probably damaging Het
Igfbp7 T C 5: 77,499,104 (GRCm39) D267G probably benign Het
Ighv1-49 C A 12: 115,019,028 (GRCm39) V56L possibly damaging Het
Ighv8-8 C T 12: 115,257,881 (GRCm39) M53I probably benign Het
Kcnj3 T A 2: 55,327,590 (GRCm39) N126K probably damaging Het
Kif12 C T 4: 63,086,730 (GRCm39) probably null Het
Lrif1 A C 3: 106,643,069 (GRCm39) I725L probably damaging Het
Lrrk2 T C 15: 91,689,123 (GRCm39) V2265A probably benign Het
Med25 T C 7: 44,532,526 (GRCm39) N438S possibly damaging Het
Mex3b A T 7: 82,519,382 (GRCm39) T566S probably benign Het
Mkx T C 18: 7,000,657 (GRCm39) N95S possibly damaging Het
Morc3 A T 16: 93,668,082 (GRCm39) D820V probably damaging Het
Mroh4 G T 15: 74,483,857 (GRCm39) N562K probably benign Het
Ndst3 A T 3: 123,346,201 (GRCm39) I276N probably damaging Het
Notch2 A G 3: 98,019,037 (GRCm39) N733S probably benign Het
Or10a5 A T 7: 106,635,526 (GRCm39) M55L probably benign Het
Or2l13b C A 16: 19,349,307 (GRCm39) R121L probably benign Het
Or51k1 G A 7: 103,661,585 (GRCm39) T108I possibly damaging Het
Or5ak24 T C 2: 85,260,895 (GRCm39) T93A probably benign Het
Or5m13 T A 2: 85,748,917 (GRCm39) I216N possibly damaging Het
Or8b38 G T 9: 37,973,068 (GRCm39) G151C probably damaging Het
Or8b44 A T 9: 38,410,585 (GRCm39) I207F probably damaging Het
Or8k37 T C 2: 86,469,833 (GRCm39) Y73C probably damaging Het
Patj A T 4: 98,383,301 (GRCm39) N268Y probably damaging Het
Pbrm1 T A 14: 30,774,173 (GRCm39) D446E probably damaging Het
Pcdhga11 A G 18: 37,891,085 (GRCm39) T698A probably benign Het
Pde6a T C 18: 61,367,790 (GRCm39) V266A probably damaging Het
Phax G T 18: 56,709,063 (GRCm39) R209L probably damaging Het
Pld2 T A 11: 70,446,524 (GRCm39) M20K probably damaging Het
Rabl3 T C 16: 37,362,220 (GRCm39) S20P probably damaging Het
Rad51 T A 2: 118,957,629 (GRCm39) V174E probably damaging Het
Rb1cc1 A G 1: 6,319,851 (GRCm39) E1090G probably benign Het
Rfc3 T C 5: 151,566,450 (GRCm39) E333G probably damaging Het
Rfx6 T G 10: 51,602,947 (GRCm39) Y821* probably null Het
Riok3 A G 18: 12,261,972 (GRCm39) D2G probably damaging Het
Rtn1 G T 12: 72,264,258 (GRCm39) A183E probably damaging Het
Skint8 T C 4: 111,796,805 (GRCm39) L303P probably damaging Het
Slc36a2 C A 11: 55,065,520 (GRCm39) V162L probably benign Het
Sorcs3 T C 19: 48,752,587 (GRCm39) V794A possibly damaging Het
Sspo A G 6: 48,444,021 (GRCm39) probably null Het
Tbk1 T C 10: 121,387,174 (GRCm39) N707S probably damaging Het
Tgfbr2 A T 9: 115,960,633 (GRCm39) H106Q probably benign Het
Trim8 A G 19: 46,491,214 (GRCm39) E111G probably benign Het
Tshz2 A G 2: 169,725,794 (GRCm39) Y130C probably damaging Het
Txndc15 T A 13: 55,865,978 (GRCm39) D147E probably benign Het
Vmn1r172 T A 7: 23,359,745 (GRCm39) L210H possibly damaging Het
Vmn1r55 A G 7: 5,150,105 (GRCm39) V106A probably damaging Het
Vmn2r49 T A 7: 9,720,214 (GRCm39) K426* probably null Het
Wnk2 C T 13: 49,210,722 (GRCm39) R206Q probably damaging Het
Zfp1007 A T 5: 109,824,941 (GRCm39) C170S possibly damaging Het
Zfp473 T C 7: 44,383,988 (GRCm39) N115S probably benign Het
Zfp536 G T 7: 37,269,161 (GRCm39) A85D probably damaging Het
Zfp853 C A 5: 143,274,584 (GRCm39) Q345H unknown Het
Other mutations in Tchhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tchhl1 APN 3 93,378,230 (GRCm39) missense probably benign 0.00
IGL00803:Tchhl1 APN 3 93,378,207 (GRCm39) missense probably benign 0.00
IGL01075:Tchhl1 APN 3 93,377,623 (GRCm39) missense probably damaging 1.00
IGL01814:Tchhl1 APN 3 93,377,656 (GRCm39) missense possibly damaging 0.53
IGL02026:Tchhl1 APN 3 93,377,862 (GRCm39) missense probably damaging 0.99
IGL02407:Tchhl1 APN 3 93,378,634 (GRCm39) missense possibly damaging 0.95
IGL03286:Tchhl1 APN 3 93,378,430 (GRCm39) missense probably benign 0.00
IGL03293:Tchhl1 APN 3 93,377,582 (GRCm39) missense probably damaging 1.00
Reef UTSW 3 93,378,336 (GRCm39) nonsense probably null
R0371:Tchhl1 UTSW 3 93,376,884 (GRCm39) missense probably damaging 1.00
R0403:Tchhl1 UTSW 3 93,378,336 (GRCm39) nonsense probably null
R0763:Tchhl1 UTSW 3 93,378,878 (GRCm39) missense probably benign 0.05
R1052:Tchhl1 UTSW 3 93,377,520 (GRCm39) missense probably benign 0.32
R1848:Tchhl1 UTSW 3 93,378,408 (GRCm39) missense probably damaging 1.00
R4917:Tchhl1 UTSW 3 93,377,623 (GRCm39) missense possibly damaging 0.52
R4918:Tchhl1 UTSW 3 93,377,623 (GRCm39) missense possibly damaging 0.52
R5251:Tchhl1 UTSW 3 93,377,860 (GRCm39) missense possibly damaging 0.70
R5260:Tchhl1 UTSW 3 93,378,102 (GRCm39) missense probably damaging 1.00
R5398:Tchhl1 UTSW 3 93,378,910 (GRCm39) missense probably benign 0.01
R5759:Tchhl1 UTSW 3 93,378,863 (GRCm39) missense probably damaging 1.00
R5760:Tchhl1 UTSW 3 93,378,863 (GRCm39) missense probably damaging 1.00
R5872:Tchhl1 UTSW 3 93,377,836 (GRCm39) missense probably benign 0.31
R6592:Tchhl1 UTSW 3 93,378,116 (GRCm39) missense probably damaging 0.99
R7464:Tchhl1 UTSW 3 93,377,971 (GRCm39) missense probably benign 0.01
R7653:Tchhl1 UTSW 3 93,378,451 (GRCm39) missense probably benign 0.01
R7726:Tchhl1 UTSW 3 93,379,065 (GRCm39) missense probably benign 0.07
R8487:Tchhl1 UTSW 3 93,376,869 (GRCm39) missense probably damaging 1.00
R9207:Tchhl1 UTSW 3 93,377,819 (GRCm39) missense possibly damaging 0.94
RF018:Tchhl1 UTSW 3 93,377,691 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCACCACTTGAGAAGCAATC -3'
(R):5'- GAGCTCAGACCATCATGCAG -3'

Sequencing Primer
(F):5'- CACCAGGATTCAGGACAA -3'
(R):5'- ATCATGCAGACCATCTCTGG -3'
Posted On 2016-04-27