Incidental Mutation 'R4945:Igfbp7'
ID381294
Institutional Source Beutler Lab
Gene Symbol Igfbp7
Ensembl Gene ENSMUSG00000036256
Gene Nameinsulin-like growth factor binding protein 7
SynonymsFstl2, mac25, AGM
MMRRC Submission 042542-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4945 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location77349240-77408041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77351257 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 267 (D267G)
Ref Sequence ENSEMBL: ENSMUSP00000045057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031167] [ENSMUST00000046746] [ENSMUST00000163898]
Predicted Effect probably benign
Transcript: ENSMUST00000031167
SMART Domains Protein: ENSMUSP00000031167
Gene: ENSMUSG00000029250

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:RNA_pol_Rpb2_1 38 442 2.5e-69 PFAM
Pfam:RNA_pol_Rpb2_2 201 394 3.7e-57 PFAM
Pfam:RNA_pol_Rpb2_3 468 532 6.1e-25 PFAM
Pfam:RNA_pol_Rpb2_4 567 629 7.4e-27 PFAM
Pfam:RNA_pol_Rpb2_5 653 700 1.6e-22 PFAM
Pfam:RNA_pol_Rpb2_6 707 1080 4.5e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1082 1174 3.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046746
AA Change: D267G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045057
Gene: ENSMUSG00000036256
AA Change: D267G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IB 30 113 9.23e-19 SMART
KAZAL 110 156 6.39e-12 SMART
IG 166 266 5.53e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163898
AA Change: D298G

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128318
Gene: ENSMUSG00000036256
AA Change: D298G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IB 30 113 9.23e-19 SMART
KAZAL 110 156 6.39e-12 SMART
IG 197 297 5.53e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the insulin-like growth factor (IGF)-binding protein (IGFBP) family. IGFBPs bind IGFs with high affinity, and regulate IGF availability in body fluids and tissues and modulate IGF binding to its receptors. This protein binds IGF-I and IGF-II with relatively low affinity, and belongs to a subfamily of low-affinity IGFBPs. It also stimulates prostacyclin production and cell adhesion. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, and one variant has been associated with retinal arterial macroaneurysm (PMID:21835307). [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit retarded mammary gland developmental in virgin and adult females, reduced mammary gland size and alveolar density during pregnancy, precocious involution in lactating mammary glands, and abnormal milk composition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,677,075 C170S possibly damaging Het
Adamts13 G A 2: 26,986,610 R512H probably damaging Het
Adgrl2 T A 3: 148,823,036 M1158L probably damaging Het
Adgrl3 C A 5: 81,512,048 H153Q probably damaging Het
Aldh1a2 C A 9: 71,215,916 Q24K probably benign Het
Atp1b1 A G 1: 164,438,298 V298A probably damaging Het
Casp8ap2 T A 4: 32,631,163 N74K possibly damaging Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cerk C G 15: 86,156,601 D186H probably benign Het
Cmtr2 T C 8: 110,221,433 F125S probably damaging Het
Col6a1 A G 10: 76,712,272 V650A unknown Het
Cuzd1 A G 7: 131,316,621 F196L probably damaging Het
Esm1 T G 13: 113,210,145 probably null Het
Fbn2 T A 18: 58,050,253 I1787F possibly damaging Het
Gm1110 T C 9: 26,920,595 M87V possibly damaging Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
Grk2 A G 19: 4,290,447 I302T probably damaging Het
Hoxb6 A G 11: 96,299,259 Y28C possibly damaging Het
Ift27 A G 15: 78,164,254 V110A probably damaging Het
Ighv1-49 C A 12: 115,055,408 V56L possibly damaging Het
Ighv8-8 C T 12: 115,294,261 M53I probably benign Het
Kcnj3 T A 2: 55,437,578 N126K probably damaging Het
Kif12 C T 4: 63,168,493 probably null Het
Lrif1 A C 3: 106,735,753 I725L probably damaging Het
Lrrk2 T C 15: 91,804,920 V2265A probably benign Het
Med25 T C 7: 44,883,102 N438S possibly damaging Het
Mex3b A T 7: 82,870,174 T566S probably benign Het
Mkx T C 18: 7,000,657 N95S possibly damaging Het
Morc3 A T 16: 93,871,194 D820V probably damaging Het
Mroh4 G T 15: 74,612,008 N562K probably benign Het
Ndst3 A T 3: 123,552,552 I276N probably damaging Het
Notch2 A G 3: 98,111,721 N733S probably benign Het
Olfr1025-ps1 T A 2: 85,918,573 I216N possibly damaging Het
Olfr1084 T C 2: 86,639,489 Y73C probably damaging Het
Olfr168 C A 16: 19,530,557 R121L probably benign Het
Olfr639 G A 7: 104,012,378 T108I possibly damaging Het
Olfr713 A T 7: 107,036,319 M55L probably benign Het
Olfr885 G T 9: 38,061,772 G151C probably damaging Het
Olfr907 A T 9: 38,499,289 I207F probably damaging Het
Olfr994 T C 2: 85,430,551 T93A probably benign Het
Patj A T 4: 98,495,064 N268Y probably damaging Het
Pbrm1 T A 14: 31,052,216 D446E probably damaging Het
Pcdhga11 A G 18: 37,758,032 T698A probably benign Het
Pde6a T C 18: 61,234,718 V266A probably damaging Het
Phax G T 18: 56,575,991 R209L probably damaging Het
Pld2 T A 11: 70,555,698 M20K probably damaging Het
Rabl3 T C 16: 37,541,858 S20P probably damaging Het
Rad51 T A 2: 119,127,148 V174E probably damaging Het
Rb1cc1 A G 1: 6,249,627 E1090G probably benign Het
Rfc3 T C 5: 151,642,985 E333G probably damaging Het
Rfx6 T G 10: 51,726,851 Y821* probably null Het
Riok3 A G 18: 12,128,915 D2G probably damaging Het
Rtn1 G T 12: 72,217,484 A183E probably damaging Het
Skint8 T C 4: 111,939,608 L303P probably damaging Het
Slc36a2 C A 11: 55,174,694 V162L probably benign Het
Sorcs3 T C 19: 48,764,148 V794A possibly damaging Het
Sspo A G 6: 48,467,087 probably null Het
Tbk1 T C 10: 121,551,269 N707S probably damaging Het
Tchhl1 A T 3: 93,471,576 H529L probably benign Het
Tgfbr2 A T 9: 116,131,565 H106Q probably benign Het
Trim8 A G 19: 46,502,775 E111G probably benign Het
Tshz2 A G 2: 169,883,874 Y130C probably damaging Het
Txndc15 T A 13: 55,718,165 D147E probably benign Het
Vmn1r172 T A 7: 23,660,320 L210H possibly damaging Het
Vmn1r55 A G 7: 5,147,106 V106A probably damaging Het
Vmn2r49 T A 7: 9,986,287 K426* probably null Het
Wnk2 C T 13: 49,057,246 R206Q probably damaging Het
Zfp473 T C 7: 44,734,564 N115S probably benign Het
Zfp536 G T 7: 37,569,736 A85D probably damaging Het
Zfp853 C A 5: 143,288,829 Q345H unknown Het
Other mutations in Igfbp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Igfbp7 APN 5 77352037 splice site probably benign
IGL01528:Igfbp7 APN 5 77351332 missense probably damaging 1.00
IGL02964:Igfbp7 APN 5 77351341 missense possibly damaging 0.65
IGL03223:Igfbp7 APN 5 77349471 utr 3 prime probably benign
R0403:Igfbp7 UTSW 5 77355591 missense probably benign 0.36
R0639:Igfbp7 UTSW 5 77351980 missense probably damaging 1.00
R4647:Igfbp7 UTSW 5 77351296 missense possibly damaging 0.93
R4688:Igfbp7 UTSW 5 77407635 missense probably damaging 1.00
R4970:Igfbp7 UTSW 5 77407761 missense possibly damaging 0.83
R7095:Igfbp7 UTSW 5 77401490 missense probably benign 0.28
R7332:Igfbp7 UTSW 5 77351956 missense probably damaging 1.00
R7751:Igfbp7 UTSW 5 77351287 missense probably damaging 1.00
R8243:Igfbp7 UTSW 5 77401492 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CATCTTGAGGCATGCAATCTGG -3'
(R):5'- GACTTCACTACTTCTCATAGCAGC -3'

Sequencing Primer
(F):5'- GAGGCATGCAATCTGGCTGTAATTAC -3'
(R):5'- TCGTCACAGGGATCCTACTAG -3'
Posted On2016-04-27