Incidental Mutation 'R4945:Vmn1r55'
ID381300
Institutional Source Beutler Lab
Gene Symbol Vmn1r55
Ensembl Gene ENSMUSG00000074402
Gene Namevomeronasal 1 receptor 55
SynonymsLOC236535, LOC384522, V1rd5
MMRRC Submission 042542-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4945 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5146218-5147501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5147106 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 106 (V106A)
Ref Sequence ENSEMBL: ENSMUSP00000096443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098844]
Predicted Effect probably damaging
Transcript: ENSMUST00000098844
AA Change: V106A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096443
Gene: ENSMUSG00000074402
AA Change: V106A

DomainStartEndE-ValueType
Pfam:TAS2R 1 286 3.7e-14 PFAM
Pfam:7tm_1 20 279 4e-8 PFAM
Pfam:V1R 31 286 5.5e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,677,075 C170S possibly damaging Het
Adamts13 G A 2: 26,986,610 R512H probably damaging Het
Adgrl2 T A 3: 148,823,036 M1158L probably damaging Het
Adgrl3 C A 5: 81,512,048 H153Q probably damaging Het
Aldh1a2 C A 9: 71,215,916 Q24K probably benign Het
Atp1b1 A G 1: 164,438,298 V298A probably damaging Het
Casp8ap2 T A 4: 32,631,163 N74K possibly damaging Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cerk C G 15: 86,156,601 D186H probably benign Het
Cmtr2 T C 8: 110,221,433 F125S probably damaging Het
Col6a1 A G 10: 76,712,272 V650A unknown Het
Cuzd1 A G 7: 131,316,621 F196L probably damaging Het
Esm1 T G 13: 113,210,145 probably null Het
Fbn2 T A 18: 58,050,253 I1787F possibly damaging Het
Gm1110 T C 9: 26,920,595 M87V possibly damaging Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
Grk2 A G 19: 4,290,447 I302T probably damaging Het
Hoxb6 A G 11: 96,299,259 Y28C possibly damaging Het
Ift27 A G 15: 78,164,254 V110A probably damaging Het
Igfbp7 T C 5: 77,351,257 D267G probably benign Het
Ighv1-49 C A 12: 115,055,408 V56L possibly damaging Het
Ighv8-8 C T 12: 115,294,261 M53I probably benign Het
Kcnj3 T A 2: 55,437,578 N126K probably damaging Het
Kif12 C T 4: 63,168,493 probably null Het
Lrif1 A C 3: 106,735,753 I725L probably damaging Het
Lrrk2 T C 15: 91,804,920 V2265A probably benign Het
Med25 T C 7: 44,883,102 N438S possibly damaging Het
Mex3b A T 7: 82,870,174 T566S probably benign Het
Mkx T C 18: 7,000,657 N95S possibly damaging Het
Morc3 A T 16: 93,871,194 D820V probably damaging Het
Mroh4 G T 15: 74,612,008 N562K probably benign Het
Ndst3 A T 3: 123,552,552 I276N probably damaging Het
Notch2 A G 3: 98,111,721 N733S probably benign Het
Olfr1025-ps1 T A 2: 85,918,573 I216N possibly damaging Het
Olfr1084 T C 2: 86,639,489 Y73C probably damaging Het
Olfr168 C A 16: 19,530,557 R121L probably benign Het
Olfr639 G A 7: 104,012,378 T108I possibly damaging Het
Olfr713 A T 7: 107,036,319 M55L probably benign Het
Olfr885 G T 9: 38,061,772 G151C probably damaging Het
Olfr907 A T 9: 38,499,289 I207F probably damaging Het
Olfr994 T C 2: 85,430,551 T93A probably benign Het
Patj A T 4: 98,495,064 N268Y probably damaging Het
Pbrm1 T A 14: 31,052,216 D446E probably damaging Het
Pcdhga11 A G 18: 37,758,032 T698A probably benign Het
Pde6a T C 18: 61,234,718 V266A probably damaging Het
Phax G T 18: 56,575,991 R209L probably damaging Het
Pld2 T A 11: 70,555,698 M20K probably damaging Het
Rabl3 T C 16: 37,541,858 S20P probably damaging Het
Rad51 T A 2: 119,127,148 V174E probably damaging Het
Rb1cc1 A G 1: 6,249,627 E1090G probably benign Het
Rfc3 T C 5: 151,642,985 E333G probably damaging Het
Rfx6 T G 10: 51,726,851 Y821* probably null Het
Riok3 A G 18: 12,128,915 D2G probably damaging Het
Rtn1 G T 12: 72,217,484 A183E probably damaging Het
Skint8 T C 4: 111,939,608 L303P probably damaging Het
Slc36a2 C A 11: 55,174,694 V162L probably benign Het
Sorcs3 T C 19: 48,764,148 V794A possibly damaging Het
Sspo A G 6: 48,467,087 probably null Het
Tbk1 T C 10: 121,551,269 N707S probably damaging Het
Tchhl1 A T 3: 93,471,576 H529L probably benign Het
Tgfbr2 A T 9: 116,131,565 H106Q probably benign Het
Trim8 A G 19: 46,502,775 E111G probably benign Het
Tshz2 A G 2: 169,883,874 Y130C probably damaging Het
Txndc15 T A 13: 55,718,165 D147E probably benign Het
Vmn1r172 T A 7: 23,660,320 L210H possibly damaging Het
Vmn2r49 T A 7: 9,986,287 K426* probably null Het
Wnk2 C T 13: 49,057,246 R206Q probably damaging Het
Zfp473 T C 7: 44,734,564 N115S probably benign Het
Zfp536 G T 7: 37,569,736 A85D probably damaging Het
Zfp853 C A 5: 143,288,829 Q345H unknown Het
Other mutations in Vmn1r55
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1771:Vmn1r55 UTSW 7 5146920 missense probably benign 0.01
R2063:Vmn1r55 UTSW 7 5147049 missense possibly damaging 0.91
R2064:Vmn1r55 UTSW 7 5147049 missense possibly damaging 0.91
R2066:Vmn1r55 UTSW 7 5147049 missense possibly damaging 0.91
R2068:Vmn1r55 UTSW 7 5147049 missense possibly damaging 0.91
R3737:Vmn1r55 UTSW 7 5147196 missense probably damaging 0.99
R4409:Vmn1r55 UTSW 7 5147076 missense probably benign 0.40
R4410:Vmn1r55 UTSW 7 5147076 missense probably benign 0.40
R4700:Vmn1r55 UTSW 7 5146587 missense probably damaging 1.00
R4700:Vmn1r55 UTSW 7 5146588 missense probably damaging 0.98
R4755:Vmn1r55 UTSW 7 5147026 missense probably damaging 1.00
R5064:Vmn1r55 UTSW 7 5146929 missense probably benign 0.00
R5186:Vmn1r55 UTSW 7 5146986 missense probably damaging 0.99
R5394:Vmn1r55 UTSW 7 5146996 missense probably damaging 1.00
R6487:Vmn1r55 UTSW 7 5146555 missense probably benign 0.23
R7855:Vmn1r55 UTSW 7 5146624 missense probably benign
R7938:Vmn1r55 UTSW 7 5146624 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATCCTCTTGCCTTGAGAATC -3'
(R):5'- CTTGACTGACTCCAGACTGAGG -3'

Sequencing Primer
(F):5'- TCTTGCCTTGAGAATCAGAGTC -3'
(R):5'- TGAGGCCCATACAGGTCATTC -3'
Posted On2016-04-27