Incidental Mutation 'R4945:Zfp536'
ID381303
Institutional Source Beutler Lab
Gene Symbol Zfp536
Ensembl Gene ENSMUSG00000043456
Gene Namezinc finger protein 536
Synonyms
MMRRC Submission 042542-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4945 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location37472135-37773641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37569736 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 85 (A85D)
Ref Sequence ENSEMBL: ENSMUSP00000135068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056338] [ENSMUST00000175941] [ENSMUST00000176114] [ENSMUST00000176205] [ENSMUST00000176534] [ENSMUST00000176680]
Predicted Effect probably damaging
Transcript: ENSMUST00000056338
AA Change: A85D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058468
Gene: ENSMUSG00000043456
AA Change: A85D

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
Pfam:zf-C2H2_assoc 657 739 6.6e-43 PFAM
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175941
AA Change: A85D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134778
Gene: ENSMUSG00000043456
AA Change: A85D

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176114
AA Change: A85D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135681
Gene: ENSMUSG00000043456
AA Change: A85D

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176205
AA Change: A85D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135068
Gene: ENSMUSG00000043456
AA Change: A85D

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176534
AA Change: A85D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000176680
AA Change: A85D

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135218
Gene: ENSMUSG00000043456
AA Change: A85D

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a highly conserved zinc finger protein. The encoded protein is most abundant in brain, where it negatively regulates neuronal differentiation. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,677,075 C170S possibly damaging Het
Adamts13 G A 2: 26,986,610 R512H probably damaging Het
Adgrl2 T A 3: 148,823,036 M1158L probably damaging Het
Adgrl3 C A 5: 81,512,048 H153Q probably damaging Het
Aldh1a2 C A 9: 71,215,916 Q24K probably benign Het
Atp1b1 A G 1: 164,438,298 V298A probably damaging Het
Casp8ap2 T A 4: 32,631,163 N74K possibly damaging Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cerk C G 15: 86,156,601 D186H probably benign Het
Cmtr2 T C 8: 110,221,433 F125S probably damaging Het
Col6a1 A G 10: 76,712,272 V650A unknown Het
Cuzd1 A G 7: 131,316,621 F196L probably damaging Het
Esm1 T G 13: 113,210,145 probably null Het
Fbn2 T A 18: 58,050,253 I1787F possibly damaging Het
Gm1110 T C 9: 26,920,595 M87V possibly damaging Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
Grk2 A G 19: 4,290,447 I302T probably damaging Het
Hoxb6 A G 11: 96,299,259 Y28C possibly damaging Het
Ift27 A G 15: 78,164,254 V110A probably damaging Het
Igfbp7 T C 5: 77,351,257 D267G probably benign Het
Ighv1-49 C A 12: 115,055,408 V56L possibly damaging Het
Ighv8-8 C T 12: 115,294,261 M53I probably benign Het
Kcnj3 T A 2: 55,437,578 N126K probably damaging Het
Kif12 C T 4: 63,168,493 probably null Het
Lrif1 A C 3: 106,735,753 I725L probably damaging Het
Lrrk2 T C 15: 91,804,920 V2265A probably benign Het
Med25 T C 7: 44,883,102 N438S possibly damaging Het
Mex3b A T 7: 82,870,174 T566S probably benign Het
Mkx T C 18: 7,000,657 N95S possibly damaging Het
Morc3 A T 16: 93,871,194 D820V probably damaging Het
Mroh4 G T 15: 74,612,008 N562K probably benign Het
Ndst3 A T 3: 123,552,552 I276N probably damaging Het
Notch2 A G 3: 98,111,721 N733S probably benign Het
Olfr1025-ps1 T A 2: 85,918,573 I216N possibly damaging Het
Olfr1084 T C 2: 86,639,489 Y73C probably damaging Het
Olfr168 C A 16: 19,530,557 R121L probably benign Het
Olfr639 G A 7: 104,012,378 T108I possibly damaging Het
Olfr713 A T 7: 107,036,319 M55L probably benign Het
Olfr885 G T 9: 38,061,772 G151C probably damaging Het
Olfr907 A T 9: 38,499,289 I207F probably damaging Het
Olfr994 T C 2: 85,430,551 T93A probably benign Het
Patj A T 4: 98,495,064 N268Y probably damaging Het
Pbrm1 T A 14: 31,052,216 D446E probably damaging Het
Pcdhga11 A G 18: 37,758,032 T698A probably benign Het
Pde6a T C 18: 61,234,718 V266A probably damaging Het
Phax G T 18: 56,575,991 R209L probably damaging Het
Pld2 T A 11: 70,555,698 M20K probably damaging Het
Rabl3 T C 16: 37,541,858 S20P probably damaging Het
Rad51 T A 2: 119,127,148 V174E probably damaging Het
Rb1cc1 A G 1: 6,249,627 E1090G probably benign Het
Rfc3 T C 5: 151,642,985 E333G probably damaging Het
Rfx6 T G 10: 51,726,851 Y821* probably null Het
Riok3 A G 18: 12,128,915 D2G probably damaging Het
Rtn1 G T 12: 72,217,484 A183E probably damaging Het
Skint8 T C 4: 111,939,608 L303P probably damaging Het
Slc36a2 C A 11: 55,174,694 V162L probably benign Het
Sorcs3 T C 19: 48,764,148 V794A possibly damaging Het
Sspo A G 6: 48,467,087 probably null Het
Tbk1 T C 10: 121,551,269 N707S probably damaging Het
Tchhl1 A T 3: 93,471,576 H529L probably benign Het
Tgfbr2 A T 9: 116,131,565 H106Q probably benign Het
Trim8 A G 19: 46,502,775 E111G probably benign Het
Tshz2 A G 2: 169,883,874 Y130C probably damaging Het
Txndc15 T A 13: 55,718,165 D147E probably benign Het
Vmn1r172 T A 7: 23,660,320 L210H possibly damaging Het
Vmn1r55 A G 7: 5,147,106 V106A probably damaging Het
Vmn2r49 T A 7: 9,986,287 K426* probably null Het
Wnk2 C T 13: 49,057,246 R206Q probably damaging Het
Zfp473 T C 7: 44,734,564 N115S probably benign Het
Zfp853 C A 5: 143,288,829 Q345H unknown Het
Other mutations in Zfp536
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Zfp536 APN 7 37567890 missense probably damaging 0.99
IGL02729:Zfp536 APN 7 37493718 missense probably damaging 1.00
PIT4453001:Zfp536 UTSW 7 37479757 missense probably benign 0.08
R0211:Zfp536 UTSW 7 37568449 missense probably damaging 1.00
R0369:Zfp536 UTSW 7 37567948 missense probably damaging 1.00
R0504:Zfp536 UTSW 7 37568818 missense probably damaging 1.00
R0554:Zfp536 UTSW 7 37480819 missense probably damaging 1.00
R1171:Zfp536 UTSW 7 37569634 missense probably damaging 1.00
R1462:Zfp536 UTSW 7 37479310 missense probably damaging 1.00
R1462:Zfp536 UTSW 7 37479310 missense probably damaging 1.00
R1699:Zfp536 UTSW 7 37569454 missense probably damaging 1.00
R1817:Zfp536 UTSW 7 37568617 missense probably damaging 1.00
R1918:Zfp536 UTSW 7 37480199 missense probably damaging 1.00
R2252:Zfp536 UTSW 7 37479389 missense probably benign 0.30
R2288:Zfp536 UTSW 7 37480348 missense probably damaging 0.98
R2509:Zfp536 UTSW 7 37567978 missense possibly damaging 0.87
R3967:Zfp536 UTSW 7 37473830 makesense probably null
R4039:Zfp536 UTSW 7 37569550 missense probably damaging 1.00
R4600:Zfp536 UTSW 7 37568493 missense probably damaging 1.00
R4706:Zfp536 UTSW 7 37569466 missense probably damaging 1.00
R4771:Zfp536 UTSW 7 37568884 missense probably damaging 1.00
R4808:Zfp536 UTSW 7 37479305 missense probably damaging 1.00
R5196:Zfp536 UTSW 7 37480760 missense probably damaging 1.00
R5506:Zfp536 UTSW 7 37568792 missense probably damaging 1.00
R5816:Zfp536 UTSW 7 37480628 missense probably damaging 1.00
R6114:Zfp536 UTSW 7 37479736 missense probably damaging 0.99
R6131:Zfp536 UTSW 7 37569712 missense probably damaging 1.00
R6156:Zfp536 UTSW 7 37473856 missense unknown
R6257:Zfp536 UTSW 7 37480405 missense probably damaging 1.00
R6864:Zfp536 UTSW 7 37568515 missense probably damaging 1.00
R6975:Zfp536 UTSW 7 37568527 missense probably damaging 1.00
R6976:Zfp536 UTSW 7 37480403 missense probably damaging 1.00
R7176:Zfp536 UTSW 7 37480851 critical splice acceptor site probably null
R7247:Zfp536 UTSW 7 37569206 missense probably benign 0.04
R7325:Zfp536 UTSW 7 37479860 missense probably benign
R7650:Zfp536 UTSW 7 37569692 missense probably damaging 1.00
R7782:Zfp536 UTSW 7 37568701 missense probably damaging 1.00
R7827:Zfp536 UTSW 7 37569688 missense probably damaging 1.00
R8013:Zfp536 UTSW 7 37569610 missense probably damaging 1.00
R8209:Zfp536 UTSW 7 37568655 missense probably benign 0.00
R8504:Zfp536 UTSW 7 37480067 missense probably benign
X0066:Zfp536 UTSW 7 37569781 missense possibly damaging 0.93
Z1176:Zfp536 UTSW 7 37493812 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGAATGGCTTCTCACCGGTG -3'
(R):5'- GTCCTCAATGGCCAGTATGC -3'

Sequencing Primer
(F):5'- TCACCGGTGTGAGTGCG -3'
(R):5'- TATGCCATGAGCCAGAAGTTGC -3'
Posted On2016-04-27