Incidental Mutation 'R4945:Olfr639'
ID381307
Institutional Source Beutler Lab
Gene Symbol Olfr639
Ensembl Gene ENSMUSG00000066263
Gene Nameolfactory receptor 639
SynonymsMOR12-1, GA_x6K02T2PBJ9-6747143-6746193
MMRRC Submission 042542-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4945 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104006231-104017303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104012378 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 108 (T108I)
Ref Sequence ENSEMBL: ENSMUSP00000149743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106862] [ENSMUST00000138055] [ENSMUST00000215653]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106862
AA Change: T108I

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102475
Gene: ENSMUSG00000066263
AA Change: T108I

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.4e-120 PFAM
Pfam:7TM_GPCR_Srsx 37 173 3.6e-9 PFAM
Pfam:7tm_1 43 294 4.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000215653
AA Change: T108I

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,677,075 C170S possibly damaging Het
Adamts13 G A 2: 26,986,610 R512H probably damaging Het
Adgrl2 T A 3: 148,823,036 M1158L probably damaging Het
Adgrl3 C A 5: 81,512,048 H153Q probably damaging Het
Aldh1a2 C A 9: 71,215,916 Q24K probably benign Het
Atp1b1 A G 1: 164,438,298 V298A probably damaging Het
Casp8ap2 T A 4: 32,631,163 N74K possibly damaging Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cerk C G 15: 86,156,601 D186H probably benign Het
Cmtr2 T C 8: 110,221,433 F125S probably damaging Het
Col6a1 A G 10: 76,712,272 V650A unknown Het
Cuzd1 A G 7: 131,316,621 F196L probably damaging Het
Esm1 T G 13: 113,210,145 probably null Het
Fbn2 T A 18: 58,050,253 I1787F possibly damaging Het
Gm1110 T C 9: 26,920,595 M87V possibly damaging Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
Grk2 A G 19: 4,290,447 I302T probably damaging Het
Hoxb6 A G 11: 96,299,259 Y28C possibly damaging Het
Ift27 A G 15: 78,164,254 V110A probably damaging Het
Igfbp7 T C 5: 77,351,257 D267G probably benign Het
Ighv1-49 C A 12: 115,055,408 V56L possibly damaging Het
Ighv8-8 C T 12: 115,294,261 M53I probably benign Het
Kcnj3 T A 2: 55,437,578 N126K probably damaging Het
Kif12 C T 4: 63,168,493 probably null Het
Lrif1 A C 3: 106,735,753 I725L probably damaging Het
Lrrk2 T C 15: 91,804,920 V2265A probably benign Het
Med25 T C 7: 44,883,102 N438S possibly damaging Het
Mex3b A T 7: 82,870,174 T566S probably benign Het
Mkx T C 18: 7,000,657 N95S possibly damaging Het
Morc3 A T 16: 93,871,194 D820V probably damaging Het
Mroh4 G T 15: 74,612,008 N562K probably benign Het
Ndst3 A T 3: 123,552,552 I276N probably damaging Het
Notch2 A G 3: 98,111,721 N733S probably benign Het
Olfr1025-ps1 T A 2: 85,918,573 I216N possibly damaging Het
Olfr1084 T C 2: 86,639,489 Y73C probably damaging Het
Olfr168 C A 16: 19,530,557 R121L probably benign Het
Olfr713 A T 7: 107,036,319 M55L probably benign Het
Olfr885 G T 9: 38,061,772 G151C probably damaging Het
Olfr907 A T 9: 38,499,289 I207F probably damaging Het
Olfr994 T C 2: 85,430,551 T93A probably benign Het
Patj A T 4: 98,495,064 N268Y probably damaging Het
Pbrm1 T A 14: 31,052,216 D446E probably damaging Het
Pcdhga11 A G 18: 37,758,032 T698A probably benign Het
Pde6a T C 18: 61,234,718 V266A probably damaging Het
Phax G T 18: 56,575,991 R209L probably damaging Het
Pld2 T A 11: 70,555,698 M20K probably damaging Het
Rabl3 T C 16: 37,541,858 S20P probably damaging Het
Rad51 T A 2: 119,127,148 V174E probably damaging Het
Rb1cc1 A G 1: 6,249,627 E1090G probably benign Het
Rfc3 T C 5: 151,642,985 E333G probably damaging Het
Rfx6 T G 10: 51,726,851 Y821* probably null Het
Riok3 A G 18: 12,128,915 D2G probably damaging Het
Rtn1 G T 12: 72,217,484 A183E probably damaging Het
Skint8 T C 4: 111,939,608 L303P probably damaging Het
Slc36a2 C A 11: 55,174,694 V162L probably benign Het
Sorcs3 T C 19: 48,764,148 V794A possibly damaging Het
Sspo A G 6: 48,467,087 probably null Het
Tbk1 T C 10: 121,551,269 N707S probably damaging Het
Tchhl1 A T 3: 93,471,576 H529L probably benign Het
Tgfbr2 A T 9: 116,131,565 H106Q probably benign Het
Trim8 A G 19: 46,502,775 E111G probably benign Het
Tshz2 A G 2: 169,883,874 Y130C probably damaging Het
Txndc15 T A 13: 55,718,165 D147E probably benign Het
Vmn1r172 T A 7: 23,660,320 L210H possibly damaging Het
Vmn1r55 A G 7: 5,147,106 V106A probably damaging Het
Vmn2r49 T A 7: 9,986,287 K426* probably null Het
Wnk2 C T 13: 49,057,246 R206Q probably damaging Het
Zfp473 T C 7: 44,734,564 N115S probably benign Het
Zfp536 G T 7: 37,569,736 A85D probably damaging Het
Zfp853 C A 5: 143,288,829 Q345H unknown Het
Other mutations in Olfr639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr639 APN 7 104012114 missense probably damaging 1.00
IGL01547:Olfr639 APN 7 104012660 missense probably benign 0.43
IGL02173:Olfr639 APN 7 104011830 missense probably damaging 1.00
IGL02707:Olfr639 APN 7 104012402 missense probably damaging 1.00
IGL03124:Olfr639 APN 7 104011794 missense probably benign
R0004:Olfr639 UTSW 7 104012431 missense probably benign 0.02
R0086:Olfr639 UTSW 7 104012054 missense probably benign 0.23
R0370:Olfr639 UTSW 7 104012059 missense probably damaging 0.99
R0599:Olfr639 UTSW 7 104012188 nonsense probably null
R1351:Olfr639 UTSW 7 104012316 missense possibly damaging 0.81
R1604:Olfr639 UTSW 7 104011955 missense probably damaging 1.00
R2314:Olfr639 UTSW 7 104012229 missense probably benign 0.09
R2656:Olfr639 UTSW 7 104011865 missense probably damaging 0.96
R4594:Olfr639 UTSW 7 104012417 missense probably benign 0.01
R4774:Olfr639 UTSW 7 104012588 missense probably benign 0.00
R4968:Olfr639 UTSW 7 104012570 missense probably damaging 1.00
R4981:Olfr639 UTSW 7 104012105 missense probably damaging 0.97
R5072:Olfr639 UTSW 7 104012118 missense probably damaging 0.97
R5982:Olfr639 UTSW 7 104011910 missense probably damaging 1.00
R6303:Olfr639 UTSW 7 104012031 missense probably damaging 1.00
R6304:Olfr639 UTSW 7 104012031 missense probably damaging 1.00
R6332:Olfr639 UTSW 7 104011773 missense probably benign 0.00
R7107:Olfr639 UTSW 7 104012282 missense probably benign 0.16
R7152:Olfr639 UTSW 7 104012019 missense probably benign
R7456:Olfr639 UTSW 7 104011838 missense possibly damaging 0.83
R7849:Olfr639 UTSW 7 104012303 missense possibly damaging 0.56
R8023:Olfr639 UTSW 7 104011799 missense probably damaging 0.97
R8082:Olfr639 UTSW 7 104012690 missense probably benign 0.04
R8215:Olfr639 UTSW 7 104012123 missense possibly damaging 0.85
R8428:Olfr639 UTSW 7 104012425 nonsense probably null
Z1177:Olfr639 UTSW 7 104012150 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGATCAAGTCTGAGTGAAGGC -3'
(R):5'- ATAGCAGTGCAGCAAGAGTC -3'

Sequencing Primer
(F):5'- TCAAGTCTGAGTGAAGGCAATAG -3'
(R):5'- TGCAGCAAGAGTCAGCTC -3'
Posted On2016-04-27