Incidental Mutation 'R4945:Aldh1a2'
ID381314
Institutional Source Beutler Lab
Gene Symbol Aldh1a2
Ensembl Gene ENSMUSG00000013584
Gene Namealdehyde dehydrogenase family 1, subfamily A2
Synonymsretinaldehyde dehydrogenase, Aldh1a7, Raldh2
MMRRC Submission 042542-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4945 (G1)
Quality Score211
Status Not validated
Chromosome9
Chromosomal Location71215789-71296243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71215916 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 24 (Q24K)
Ref Sequence ENSEMBL: ENSMUSP00000034723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034723]
Predicted Effect probably benign
Transcript: ENSMUST00000034723
AA Change: Q24K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034723
Gene: ENSMUSG00000013584
AA Change: Q24K

DomainStartEndE-ValueType
Pfam:Aldedh 46 509 2.5e-187 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. The product of this gene is an enzyme that catalyzes the synthesis of retinoic acid (RA) from retinaldehyde. Retinoic acid, the active derivative of vitamin A (retinol), is a hormonal signaling molecule that functions in developing and adult tissues. The studies of a similar mouse gene suggest that this enzyme and the cytochrome CYP26A1, concurrently establish local embryonic retinoic acid levels which facilitate posterior organ development and prevent spina bifida. Four transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygotes for null mutations are largely devoid of retinoic acid and die by embryonic day 10.5 with impaired hindbrain development, failure to turn, lack of limb buds, heart abnormalities, reduced otocysts and a truncated frontonasal region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,677,075 C170S possibly damaging Het
Adamts13 G A 2: 26,986,610 R512H probably damaging Het
Adgrl2 T A 3: 148,823,036 M1158L probably damaging Het
Adgrl3 C A 5: 81,512,048 H153Q probably damaging Het
Atp1b1 A G 1: 164,438,298 V298A probably damaging Het
Casp8ap2 T A 4: 32,631,163 N74K possibly damaging Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cerk C G 15: 86,156,601 D186H probably benign Het
Cmtr2 T C 8: 110,221,433 F125S probably damaging Het
Col6a1 A G 10: 76,712,272 V650A unknown Het
Cuzd1 A G 7: 131,316,621 F196L probably damaging Het
Esm1 T G 13: 113,210,145 probably null Het
Fbn2 T A 18: 58,050,253 I1787F possibly damaging Het
Gm1110 T C 9: 26,920,595 M87V possibly damaging Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
Grk2 A G 19: 4,290,447 I302T probably damaging Het
Hoxb6 A G 11: 96,299,259 Y28C possibly damaging Het
Ift27 A G 15: 78,164,254 V110A probably damaging Het
Igfbp7 T C 5: 77,351,257 D267G probably benign Het
Ighv1-49 C A 12: 115,055,408 V56L possibly damaging Het
Ighv8-8 C T 12: 115,294,261 M53I probably benign Het
Kcnj3 T A 2: 55,437,578 N126K probably damaging Het
Kif12 C T 4: 63,168,493 probably null Het
Lrif1 A C 3: 106,735,753 I725L probably damaging Het
Lrrk2 T C 15: 91,804,920 V2265A probably benign Het
Med25 T C 7: 44,883,102 N438S possibly damaging Het
Mex3b A T 7: 82,870,174 T566S probably benign Het
Mkx T C 18: 7,000,657 N95S possibly damaging Het
Morc3 A T 16: 93,871,194 D820V probably damaging Het
Mroh4 G T 15: 74,612,008 N562K probably benign Het
Ndst3 A T 3: 123,552,552 I276N probably damaging Het
Notch2 A G 3: 98,111,721 N733S probably benign Het
Olfr1025-ps1 T A 2: 85,918,573 I216N possibly damaging Het
Olfr1084 T C 2: 86,639,489 Y73C probably damaging Het
Olfr168 C A 16: 19,530,557 R121L probably benign Het
Olfr639 G A 7: 104,012,378 T108I possibly damaging Het
Olfr713 A T 7: 107,036,319 M55L probably benign Het
Olfr885 G T 9: 38,061,772 G151C probably damaging Het
Olfr907 A T 9: 38,499,289 I207F probably damaging Het
Olfr994 T C 2: 85,430,551 T93A probably benign Het
Patj A T 4: 98,495,064 N268Y probably damaging Het
Pbrm1 T A 14: 31,052,216 D446E probably damaging Het
Pcdhga11 A G 18: 37,758,032 T698A probably benign Het
Pde6a T C 18: 61,234,718 V266A probably damaging Het
Phax G T 18: 56,575,991 R209L probably damaging Het
Pld2 T A 11: 70,555,698 M20K probably damaging Het
Rabl3 T C 16: 37,541,858 S20P probably damaging Het
Rad51 T A 2: 119,127,148 V174E probably damaging Het
Rb1cc1 A G 1: 6,249,627 E1090G probably benign Het
Rfc3 T C 5: 151,642,985 E333G probably damaging Het
Rfx6 T G 10: 51,726,851 Y821* probably null Het
Riok3 A G 18: 12,128,915 D2G probably damaging Het
Rtn1 G T 12: 72,217,484 A183E probably damaging Het
Skint8 T C 4: 111,939,608 L303P probably damaging Het
Slc36a2 C A 11: 55,174,694 V162L probably benign Het
Sorcs3 T C 19: 48,764,148 V794A possibly damaging Het
Sspo A G 6: 48,467,087 probably null Het
Tbk1 T C 10: 121,551,269 N707S probably damaging Het
Tchhl1 A T 3: 93,471,576 H529L probably benign Het
Tgfbr2 A T 9: 116,131,565 H106Q probably benign Het
Trim8 A G 19: 46,502,775 E111G probably benign Het
Tshz2 A G 2: 169,883,874 Y130C probably damaging Het
Txndc15 T A 13: 55,718,165 D147E probably benign Het
Vmn1r172 T A 7: 23,660,320 L210H possibly damaging Het
Vmn1r55 A G 7: 5,147,106 V106A probably damaging Het
Vmn2r49 T A 7: 9,986,287 K426* probably null Het
Wnk2 C T 13: 49,057,246 R206Q probably damaging Het
Zfp473 T C 7: 44,734,564 N115S probably benign Het
Zfp536 G T 7: 37,569,736 A85D probably damaging Het
Zfp853 C A 5: 143,288,829 Q345H unknown Het
Other mutations in Aldh1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Aldh1a2 APN 9 71215969 splice site probably benign
IGL01327:Aldh1a2 APN 9 71285966 missense possibly damaging 0.95
IGL02293:Aldh1a2 APN 9 71285277 splice site probably null
IGL03380:Aldh1a2 APN 9 71255117 nonsense probably null
R0574:Aldh1a2 UTSW 9 71281708 critical splice donor site probably null
R1189:Aldh1a2 UTSW 9 71263823 missense possibly damaging 0.69
R1217:Aldh1a2 UTSW 9 71281682 missense possibly damaging 0.94
R1270:Aldh1a2 UTSW 9 71281706 missense probably benign 0.03
R1445:Aldh1a2 UTSW 9 71285210 missense possibly damaging 0.82
R1717:Aldh1a2 UTSW 9 71293671 missense probably damaging 0.99
R1737:Aldh1a2 UTSW 9 71285171 missense possibly damaging 0.56
R1755:Aldh1a2 UTSW 9 71261741 nonsense probably null
R1984:Aldh1a2 UTSW 9 71253052 missense probably damaging 1.00
R2248:Aldh1a2 UTSW 9 71215862 missense possibly damaging 0.90
R2407:Aldh1a2 UTSW 9 71252598 missense probably damaging 0.99
R3772:Aldh1a2 UTSW 9 71252920 missense probably damaging 1.00
R5042:Aldh1a2 UTSW 9 71285004 missense possibly damaging 0.69
R5066:Aldh1a2 UTSW 9 71281700 missense possibly damaging 0.82
R5406:Aldh1a2 UTSW 9 71255121 missense possibly damaging 0.93
R5425:Aldh1a2 UTSW 9 71253004 missense probably benign 0.00
R5588:Aldh1a2 UTSW 9 71283450 missense probably damaging 1.00
R6048:Aldh1a2 UTSW 9 71261767 missense probably damaging 0.98
R6455:Aldh1a2 UTSW 9 71252914 critical splice acceptor site probably null
R6642:Aldh1a2 UTSW 9 71252986 missense probably damaging 1.00
R7253:Aldh1a2 UTSW 9 71215934 missense probably benign
R7514:Aldh1a2 UTSW 9 71284963 missense probably damaging 1.00
R7981:Aldh1a2 UTSW 9 71263820 missense probably damaging 1.00
RF018:Aldh1a2 UTSW 9 71285270 missense probably damaging 1.00
Z1177:Aldh1a2 UTSW 9 71283522 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GCACGTCCAATAAGAAGCGC -3'
(R):5'- ATAGGGGACTCCAGAACCAG -3'

Sequencing Primer
(F):5'- GACACCTGCCTATATACAGC -3'
(R):5'- AGGTCTGCTCTGGGAAATCC -3'
Posted On2016-04-27