Incidental Mutation 'R0400:Galnt7'
ID 38134
Institutional Source Beutler Lab
Gene Symbol Galnt7
Ensembl Gene ENSMUSG00000031608
Gene Name polypeptide N-acetylgalactosaminyltransferase 7
Synonyms ppGaNTase-T7
MMRRC Submission 038605-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock # R0400 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 57523828-57653032 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57583989 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 122 (Y122C)
Ref Sequence ENSEMBL: ENSMUSP00000105945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]
AlphaFold Q80VA0
Predicted Effect probably damaging
Transcript: ENSMUST00000034021
AA Change: Y122C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608
AA Change: Y122C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 3e-28 PFAM
Pfam:Glyco_tranf_2_2 210 490 2e-7 PFAM
Pfam:Glyco_transf_7C 375 445 1.8e-8 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110316
AA Change: Y122C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608
AA Change: Y122C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 8.2e-27 PFAM
Pfam:Glyco_tranf_2_2 210 490 1.3e-7 PFAM
Pfam:Glyco_transf_7C 369 445 9.3e-9 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156907
Meta Mutation Damage Score 0.3731 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik T A 11: 30,426,360 H169L probably benign Het
9130230L23Rik T C 5: 65,990,356 D28G unknown Het
Abca12 T A 1: 71,259,776 probably benign Het
Acsl5 T C 19: 55,293,711 V573A probably damaging Het
Agap1 A G 1: 89,843,250 probably benign Het
Arid2 A G 15: 96,356,925 probably benign Het
B430305J03Rik T A 3: 61,364,135 probably benign Het
Brsk2 T C 7: 141,998,553 L584P probably damaging Het
C2cd4c A G 10: 79,613,209 Y35H probably damaging Het
Cacul1 A G 19: 60,563,153 probably benign Het
Cers3 T C 7: 66,764,330 V88A probably benign Het
Cnnm1 A T 19: 43,468,364 H614L probably damaging Het
Col1a1 T A 11: 94,941,369 probably benign Het
Cyp1b1 T A 17: 79,713,587 D242V probably damaging Het
Cyp4a31 T C 4: 115,563,718 M1T probably null Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dclk2 A T 3: 86,813,747 probably null Het
Ddx58 A G 4: 40,235,257 Y78H probably benign Het
Dnah17 A G 11: 118,082,078 S2010P probably damaging Het
Dram2 T C 3: 106,573,618 L246P probably damaging Het
Dus2 A T 8: 106,048,677 T279S probably benign Het
Epn2 T C 11: 61,532,696 probably null Het
Esco2 C A 14: 65,831,706 V52F possibly damaging Het
Fbp1 T A 13: 62,865,068 T104S probably benign Het
Foxj2 A T 6: 122,833,808 Q249L possibly damaging Het
Gimd1 T C 3: 132,634,827 Y35H probably benign Het
Gipc2 A G 3: 152,165,668 F74L probably damaging Het
Glt1d1 T A 5: 127,657,075 probably benign Het
Hmcn2 A G 2: 31,400,129 T2325A probably damaging Het
Iffo1 A G 6: 125,153,471 K471R probably damaging Het
Ireb2 G A 9: 54,896,498 R491H probably benign Het
Isg20 A G 7: 78,916,725 N141D possibly damaging Het
Kmt5c G A 7: 4,746,244 R100H probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrn4 A C 2: 132,878,020 F287V probably benign Het
Mmrn1 A C 6: 60,977,115 K793N probably benign Het
Muc16 A G 9: 18,510,534 V8227A possibly damaging Het
Myh2 C T 11: 67,192,598 probably benign Het
Nalcn T A 14: 123,290,960 probably benign Het
Nfia T C 4: 98,063,136 V400A probably damaging Het
Nxph4 T A 10: 127,526,258 T255S possibly damaging Het
Olfm5 G A 7: 104,154,179 T359I probably damaging Het
Olfr141 A G 2: 86,806,651 M116T probably damaging Het
Olfr393 T C 11: 73,848,041 Y28C probably benign Het
Olfr907 A G 9: 38,498,911 M81V possibly damaging Het
Olfr935 G T 9: 38,995,198 P79Q probably damaging Het
Pak7 T C 2: 136,097,579 I545M possibly damaging Het
Pcdhb15 T C 18: 37,475,895 F727L probably benign Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Phlpp1 T A 1: 106,392,934 I1553N probably benign Het
Pink1 T C 4: 138,317,918 T282A probably damaging Het
Prdm2 A G 4: 143,111,670 F1706S probably benign Het
Pycr1 G A 11: 120,641,526 probably benign Het
Skint9 A G 4: 112,414,001 S71P probably damaging Het
Smad1 A G 8: 79,371,770 probably benign Het
Snapc5 A T 9: 64,180,507 E33D probably damaging Het
Snrnp40 T C 4: 130,362,650 L56P probably damaging Het
Stab2 A C 10: 86,872,610 I1697S probably damaging Het
Tfap2a G T 13: 40,717,412 probably benign Het
Tmem57 T C 4: 134,828,116 K349E probably benign Het
Tph2 A G 10: 115,080,120 probably benign Het
Triml1 A G 8: 43,141,040 V118A probably benign Het
Ttbk2 T A 2: 120,750,242 T538S probably benign Het
Ttn A G 2: 76,715,272 V32569A possibly damaging Het
U2af1 T A 17: 31,648,192 Y158F probably benign Het
Usp7 A T 16: 8,716,632 probably benign Het
Vdr A G 15: 97,869,351 S179P probably benign Het
Vps13d A C 4: 145,065,827 S663A probably benign Het
Wdr62 T A 7: 30,241,462 T844S possibly damaging Het
Wipi1 C T 11: 109,577,130 R407Q probably damaging Het
Zbtb43 A G 2: 33,453,897 C439R probably damaging Het
Zfp507 T A 7: 35,791,746 H704L probably damaging Het
Zzef1 G A 11: 72,895,242 R2080K probably damaging Het
Other mutations in Galnt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Galnt7 APN 8 57540039 missense probably damaging 1.00
IGL00538:Galnt7 APN 8 57552522 missense possibly damaging 0.95
IGL00826:Galnt7 APN 8 57540071 nonsense probably null
IGL00951:Galnt7 APN 8 57583824 missense probably damaging 0.96
IGL01662:Galnt7 APN 8 57531735 splice site probably benign
IGL02280:Galnt7 APN 8 57536790 missense probably damaging 1.00
IGL02832:Galnt7 APN 8 57552497 missense probably damaging 1.00
IGL02936:Galnt7 APN 8 57584214 missense probably benign
IGL03083:Galnt7 APN 8 57526189 missense probably damaging 0.98
IGL03387:Galnt7 APN 8 57526178 missense probably benign 0.01
R0553:Galnt7 UTSW 8 57552430 splice site probably benign
R1463:Galnt7 UTSW 8 57652858 missense probably benign
R1487:Galnt7 UTSW 8 57540039 missense probably damaging 1.00
R1791:Galnt7 UTSW 8 57542530 missense probably benign 0.05
R1817:Galnt7 UTSW 8 57538178 missense probably damaging 1.00
R1962:Galnt7 UTSW 8 57532714 missense probably benign 0.13
R3855:Galnt7 UTSW 8 57532624 splice site probably benign
R3856:Galnt7 UTSW 8 57532624 splice site probably benign
R4232:Galnt7 UTSW 8 57652966 missense probably benign
R4396:Galnt7 UTSW 8 57538181 missense probably damaging 1.00
R4426:Galnt7 UTSW 8 57552572 nonsense probably null
R4610:Galnt7 UTSW 8 57545769 missense probably damaging 0.99
R4745:Galnt7 UTSW 8 57542727 intron probably benign
R4794:Galnt7 UTSW 8 57545363 missense probably damaging 1.00
R5014:Galnt7 UTSW 8 57545380 missense probably damaging 1.00
R5177:Galnt7 UTSW 8 57584027 missense possibly damaging 0.87
R5682:Galnt7 UTSW 8 57583933 nonsense probably null
R6122:Galnt7 UTSW 8 57526166 missense probably damaging 0.99
R6276:Galnt7 UTSW 8 57536578 splice site probably null
R6684:Galnt7 UTSW 8 57538109 missense probably benign 0.16
R6752:Galnt7 UTSW 8 57652951 missense probably damaging 1.00
R7464:Galnt7 UTSW 8 57584020 missense possibly damaging 0.95
R7491:Galnt7 UTSW 8 57552518 missense probably damaging 0.97
R7547:Galnt7 UTSW 8 57583962 missense possibly damaging 0.48
R8093:Galnt7 UTSW 8 57532705 missense probably benign 0.00
R8221:Galnt7 UTSW 8 57552566 missense possibly damaging 0.93
R8248:Galnt7 UTSW 8 57538188 missense probably benign 0.34
R8402:Galnt7 UTSW 8 57542919 missense probably damaging 0.98
R8779:Galnt7 UTSW 8 57584211 missense probably benign
R8894:Galnt7 UTSW 8 57526142 nonsense probably null
R8974:Galnt7 UTSW 8 57652900 missense
R9106:Galnt7 UTSW 8 57532695 missense probably damaging 1.00
R9297:Galnt7 UTSW 8 57542521 missense probably damaging 0.98
X0050:Galnt7 UTSW 8 57552444 frame shift probably null
X0062:Galnt7 UTSW 8 57583908 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGTGAGATCATGTCACTTGCCACC -3'
(R):5'- ATGTCAATAACCCCTTGCCTAACCG -3'

Sequencing Primer
(F):5'- ATGTCACTTGCCACCATGTTAAATC -3'
(R):5'- CTAGCTCCTGGAGATGACAGATTC -3'
Posted On 2013-05-23