Mutagenetix > Incidental Mutations

Incidental Mutation 'R0400:Galnt7'

38134

Institutional Source

Beutler Lab

Gene Symbol

Galnt7

Ensembl Gene

ENSMUSG00000031608

Gene Name

polypeptide N-acetylgalactosaminyltransferase 7

Synonyms

ppGaNTase-T7

MMRRC Submission

038605-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.785) question?

Stock #

R0400 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57523828-57653032 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57583989 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 122 (Y122C)

Ref Sequence

ENSEMBL: ENSMUSP00000105945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]

AlphaFold

Q80VA0

Predicted Effect

probably damaging
Transcript: ENSMUST00000034021
AA Change: Y122C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608
AA Change: Y122C

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
Pfam:Glycos_transf_2	210	399	3e-28	PFAM
Pfam:Glyco_tranf_2_2	210	490	2e-7	PFAM
Pfam:Glyco_transf_7C	375	445	1.8e-8	PFAM
RICIN	531	652	3.39e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110316
AA Change: Y122C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608
AA Change: Y122C

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
Pfam:Glycos_transf_2	210	399	8.2e-27	PFAM
Pfam:Glyco_tranf_2_2	210	490	1.3e-7	PFAM
Pfam:Glyco_transf_7C	369	445	9.3e-9	PFAM
RICIN	531	652	3.39e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156907

Meta Mutation Damage Score

0.3731

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.8%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	T	A	11: 30,426,360	H169L	probably benign	Het
9130230L23Rik	T	C	5: 65,990,356	D28G	unknown	Het
Abca12	T	A	1: 71,259,776		probably benign	Het
Acsl5	T	C	19: 55,293,711	V573A	probably damaging	Het
Agap1	A	G	1: 89,843,250		probably benign	Het
Arid2	A	G	15: 96,356,925		probably benign	Het
B430305J03Rik	T	A	3: 61,364,135		probably benign	Het
Brsk2	T	C	7: 141,998,553	L584P	probably damaging	Het
C2cd4c	A	G	10: 79,613,209	Y35H	probably damaging	Het
Cacul1	A	G	19: 60,563,153		probably benign	Het
Cers3	T	C	7: 66,764,330	V88A	probably benign	Het
Cnnm1	A	T	19: 43,468,364	H614L	probably damaging	Het
Col1a1	T	A	11: 94,941,369		probably benign	Het
Cyp1b1	T	A	17: 79,713,587	D242V	probably damaging	Het
Cyp4a31	T	C	4: 115,563,718	M1T	probably null	Het
Dbn1	C	T	13: 55,474,916	E585K	probably damaging	Het
Dclk2	A	T	3: 86,813,747		probably null	Het
Ddx58	A	G	4: 40,235,257	Y78H	probably benign	Het
Dnah17	A	G	11: 118,082,078	S2010P	probably damaging	Het
Dram2	T	C	3: 106,573,618	L246P	probably damaging	Het
Dus2	A	T	8: 106,048,677	T279S	probably benign	Het
Epn2	T	C	11: 61,532,696		probably null	Het
Esco2	C	A	14: 65,831,706	V52F	possibly damaging	Het
Fbp1	T	A	13: 62,865,068	T104S	probably benign	Het
Foxj2	A	T	6: 122,833,808	Q249L	possibly damaging	Het
Gimd1	T	C	3: 132,634,827	Y35H	probably benign	Het
Gipc2	A	G	3: 152,165,668	F74L	probably damaging	Het
Glt1d1	T	A	5: 127,657,075		probably benign	Het
Hmcn2	A	G	2: 31,400,129	T2325A	probably damaging	Het
Iffo1	A	G	6: 125,153,471	K471R	probably damaging	Het
Ireb2	G	A	9: 54,896,498	R491H	probably benign	Het
Isg20	A	G	7: 78,916,725	N141D	possibly damaging	Het
Kmt5c	G	A	7: 4,746,244	R100H	probably benign	Het
Lrp1b	T	C	2: 40,750,914	D3506G	probably benign	Het
Lrrn4	A	C	2: 132,878,020	F287V	probably benign	Het
Mmrn1	A	C	6: 60,977,115	K793N	probably benign	Het
Muc16	A	G	9: 18,510,534	V8227A	possibly damaging	Het
Myh2	C	T	11: 67,192,598		probably benign	Het
Nalcn	T	A	14: 123,290,960		probably benign	Het
Nfia	T	C	4: 98,063,136	V400A	probably damaging	Het
Nxph4	T	A	10: 127,526,258	T255S	possibly damaging	Het
Olfm5	G	A	7: 104,154,179	T359I	probably damaging	Het
Olfr141	A	G	2: 86,806,651	M116T	probably damaging	Het
Olfr393	T	C	11: 73,848,041	Y28C	probably benign	Het
Olfr907	A	G	9: 38,498,911	M81V	possibly damaging	Het
Olfr935	G	T	9: 38,995,198	P79Q	probably damaging	Het
Pak7	T	C	2: 136,097,579	I545M	possibly damaging	Het
Pcdhb15	T	C	18: 37,475,895	F727L	probably benign	Het
Pds5b	T	A	5: 150,723,353	N202K	possibly damaging	Het
Phlpp1	T	A	1: 106,392,934	I1553N	probably benign	Het
Pink1	T	C	4: 138,317,918	T282A	probably damaging	Het
Prdm2	A	G	4: 143,111,670	F1706S	probably benign	Het
Pycr1	G	A	11: 120,641,526		probably benign	Het
Skint9	A	G	4: 112,414,001	S71P	probably damaging	Het
Smad1	A	G	8: 79,371,770		probably benign	Het
Snapc5	A	T	9: 64,180,507	E33D	probably damaging	Het
Snrnp40	T	C	4: 130,362,650	L56P	probably damaging	Het
Stab2	A	C	10: 86,872,610	I1697S	probably damaging	Het
Tfap2a	G	T	13: 40,717,412		probably benign	Het
Tmem57	T	C	4: 134,828,116	K349E	probably benign	Het
Tph2	A	G	10: 115,080,120		probably benign	Het
Triml1	A	G	8: 43,141,040	V118A	probably benign	Het
Ttbk2	T	A	2: 120,750,242	T538S	probably benign	Het
Ttn	A	G	2: 76,715,272	V32569A	possibly damaging	Het
U2af1	T	A	17: 31,648,192	Y158F	probably benign	Het
Usp7	A	T	16: 8,716,632		probably benign	Het
Vdr	A	G	15: 97,869,351	S179P	probably benign	Het
Vps13d	A	C	4: 145,065,827	S663A	probably benign	Het
Wdr62	T	A	7: 30,241,462	T844S	possibly damaging	Het
Wipi1	C	T	11: 109,577,130	R407Q	probably damaging	Het
Zbtb43	A	G	2: 33,453,897	C439R	probably damaging	Het
Zfp507	T	A	7: 35,791,746	H704L	probably damaging	Het
Zzef1	G	A	11: 72,895,242	R2080K	probably damaging	Het

Other mutations in Galnt7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Galnt7	APN	8	57540039	missense	probably damaging	1.00
IGL00538:Galnt7	APN	8	57552522	missense	possibly damaging	0.95
IGL00826:Galnt7	APN	8	57540071	nonsense	probably null
IGL00951:Galnt7	APN	8	57583824	missense	probably damaging	0.96
IGL01662:Galnt7	APN	8	57531735	splice site	probably benign
IGL02280:Galnt7	APN	8	57536790	missense	probably damaging	1.00
IGL02832:Galnt7	APN	8	57552497	missense	probably damaging	1.00
IGL02936:Galnt7	APN	8	57584214	missense	probably benign
IGL03083:Galnt7	APN	8	57526189	missense	probably damaging	0.98
IGL03387:Galnt7	APN	8	57526178	missense	probably benign	0.01
R0553:Galnt7	UTSW	8	57552430	splice site	probably benign
R1463:Galnt7	UTSW	8	57652858	missense	probably benign
R1487:Galnt7	UTSW	8	57540039	missense	probably damaging	1.00
R1791:Galnt7	UTSW	8	57542530	missense	probably benign	0.05
R1817:Galnt7	UTSW	8	57538178	missense	probably damaging	1.00
R1962:Galnt7	UTSW	8	57532714	missense	probably benign	0.13
R3855:Galnt7	UTSW	8	57532624	splice site	probably benign
R3856:Galnt7	UTSW	8	57532624	splice site	probably benign
R4232:Galnt7	UTSW	8	57652966	missense	probably benign
R4396:Galnt7	UTSW	8	57538181	missense	probably damaging	1.00
R4426:Galnt7	UTSW	8	57552572	nonsense	probably null
R4610:Galnt7	UTSW	8	57545769	missense	probably damaging	0.99
R4745:Galnt7	UTSW	8	57542727	intron	probably benign
R4794:Galnt7	UTSW	8	57545363	missense	probably damaging	1.00
R5014:Galnt7	UTSW	8	57545380	missense	probably damaging	1.00
R5177:Galnt7	UTSW	8	57584027	missense	possibly damaging	0.87
R5682:Galnt7	UTSW	8	57583933	nonsense	probably null
R6122:Galnt7	UTSW	8	57526166	missense	probably damaging	0.99
R6276:Galnt7	UTSW	8	57536578	splice site	probably null
R6684:Galnt7	UTSW	8	57538109	missense	probably benign	0.16
R6752:Galnt7	UTSW	8	57652951	missense	probably damaging	1.00
R7464:Galnt7	UTSW	8	57584020	missense	possibly damaging	0.95
R7491:Galnt7	UTSW	8	57552518	missense	probably damaging	0.97
R7547:Galnt7	UTSW	8	57583962	missense	possibly damaging	0.48
R8093:Galnt7	UTSW	8	57532705	missense	probably benign	0.00
R8221:Galnt7	UTSW	8	57552566	missense	possibly damaging	0.93
R8248:Galnt7	UTSW	8	57538188	missense	probably benign	0.34
R8402:Galnt7	UTSW	8	57542919	missense	probably damaging	0.98
R8779:Galnt7	UTSW	8	57584211	missense	probably benign
R8894:Galnt7	UTSW	8	57526142	nonsense	probably null
R8974:Galnt7	UTSW	8	57652900	missense
R9106:Galnt7	UTSW	8	57532695	missense	probably damaging	1.00
R9297:Galnt7	UTSW	8	57542521	missense	probably damaging	0.98
X0050:Galnt7	UTSW	8	57552444	frame shift	probably null
X0062:Galnt7	UTSW	8	57583908	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CAGTGAGATCATGTCACTTGCCACC -3'
(R):5'- ATGTCAATAACCCCTTGCCTAACCG -3'

Sequencing Primer
(F):5'- ATGTCACTTGCCACCATGTTAAATC -3'
(R):5'- CTAGCTCCTGGAGATGACAGATTC -3'

Posted On

2013-05-23