Incidental Mutation 'R0400:Olfr935'
ID 38139
Institutional Source Beutler Lab
Gene Symbol Olfr935
Ensembl Gene ENSMUSG00000059595
Gene Name olfactory receptor 935
Synonyms GA_x6K02T2PVTD-32691280-32690354, MOR171-11
MMRRC Submission 038605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R0400 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 38993971-38999683 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 38995198 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 79 (P79Q)
Ref Sequence ENSEMBL: ENSMUSP00000149193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080748] [ENSMUST00000214157]
AlphaFold Q8VG16
Predicted Effect probably damaging
Transcript: ENSMUST00000080748
AA Change: P79Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079572
Gene: ENSMUSG00000059595
AA Change: P79Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4e-53 PFAM
Pfam:7tm_1 41 290 1.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214157
AA Change: P79Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik T A 11: 30,426,360 H169L probably benign Het
9130230L23Rik T C 5: 65,990,356 D28G unknown Het
Abca12 T A 1: 71,259,776 probably benign Het
Acsl5 T C 19: 55,293,711 V573A probably damaging Het
Agap1 A G 1: 89,843,250 probably benign Het
Arid2 A G 15: 96,356,925 probably benign Het
B430305J03Rik T A 3: 61,364,135 probably benign Het
Brsk2 T C 7: 141,998,553 L584P probably damaging Het
C2cd4c A G 10: 79,613,209 Y35H probably damaging Het
Cacul1 A G 19: 60,563,153 probably benign Het
Cers3 T C 7: 66,764,330 V88A probably benign Het
Cnnm1 A T 19: 43,468,364 H614L probably damaging Het
Col1a1 T A 11: 94,941,369 probably benign Het
Cyp1b1 T A 17: 79,713,587 D242V probably damaging Het
Cyp4a31 T C 4: 115,563,718 M1T probably null Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dclk2 A T 3: 86,813,747 probably null Het
Ddx58 A G 4: 40,235,257 Y78H probably benign Het
Dnah17 A G 11: 118,082,078 S2010P probably damaging Het
Dram2 T C 3: 106,573,618 L246P probably damaging Het
Dus2 A T 8: 106,048,677 T279S probably benign Het
Epn2 T C 11: 61,532,696 probably null Het
Esco2 C A 14: 65,831,706 V52F possibly damaging Het
Fbp1 T A 13: 62,865,068 T104S probably benign Het
Foxj2 A T 6: 122,833,808 Q249L possibly damaging Het
Galnt7 T C 8: 57,583,989 Y122C probably damaging Het
Gimd1 T C 3: 132,634,827 Y35H probably benign Het
Gipc2 A G 3: 152,165,668 F74L probably damaging Het
Glt1d1 T A 5: 127,657,075 probably benign Het
Hmcn2 A G 2: 31,400,129 T2325A probably damaging Het
Iffo1 A G 6: 125,153,471 K471R probably damaging Het
Ireb2 G A 9: 54,896,498 R491H probably benign Het
Isg20 A G 7: 78,916,725 N141D possibly damaging Het
Kmt5c G A 7: 4,746,244 R100H probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrn4 A C 2: 132,878,020 F287V probably benign Het
Mmrn1 A C 6: 60,977,115 K793N probably benign Het
Muc16 A G 9: 18,510,534 V8227A possibly damaging Het
Myh2 C T 11: 67,192,598 probably benign Het
Nalcn T A 14: 123,290,960 probably benign Het
Nfia T C 4: 98,063,136 V400A probably damaging Het
Nxph4 T A 10: 127,526,258 T255S possibly damaging Het
Olfm5 G A 7: 104,154,179 T359I probably damaging Het
Olfr141 A G 2: 86,806,651 M116T probably damaging Het
Olfr393 T C 11: 73,848,041 Y28C probably benign Het
Olfr907 A G 9: 38,498,911 M81V possibly damaging Het
Pak7 T C 2: 136,097,579 I545M possibly damaging Het
Pcdhb15 T C 18: 37,475,895 F727L probably benign Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Phlpp1 T A 1: 106,392,934 I1553N probably benign Het
Pink1 T C 4: 138,317,918 T282A probably damaging Het
Prdm2 A G 4: 143,111,670 F1706S probably benign Het
Pycr1 G A 11: 120,641,526 probably benign Het
Skint9 A G 4: 112,414,001 S71P probably damaging Het
Smad1 A G 8: 79,371,770 probably benign Het
Snapc5 A T 9: 64,180,507 E33D probably damaging Het
Snrnp40 T C 4: 130,362,650 L56P probably damaging Het
Stab2 A C 10: 86,872,610 I1697S probably damaging Het
Tfap2a G T 13: 40,717,412 probably benign Het
Tmem57 T C 4: 134,828,116 K349E probably benign Het
Tph2 A G 10: 115,080,120 probably benign Het
Triml1 A G 8: 43,141,040 V118A probably benign Het
Ttbk2 T A 2: 120,750,242 T538S probably benign Het
Ttn A G 2: 76,715,272 V32569A possibly damaging Het
U2af1 T A 17: 31,648,192 Y158F probably benign Het
Usp7 A T 16: 8,716,632 probably benign Het
Vdr A G 15: 97,869,351 S179P probably benign Het
Vps13d A C 4: 145,065,827 S663A probably benign Het
Wdr62 T A 7: 30,241,462 T844S possibly damaging Het
Wipi1 C T 11: 109,577,130 R407Q probably damaging Het
Zbtb43 A G 2: 33,453,897 C439R probably damaging Het
Zfp507 T A 7: 35,791,746 H704L probably damaging Het
Zzef1 G A 11: 72,895,242 R2080K probably damaging Het
Other mutations in Olfr935
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Olfr935 APN 9 38995100 missense probably benign 0.08
IGL01671:Olfr935 APN 9 38994853 missense probably benign 0.05
IGL02331:Olfr935 APN 9 38995106 missense probably damaging 0.99
IGL03069:Olfr935 APN 9 38995432 start codon destroyed probably null 0.98
IGL03143:Olfr935 APN 9 38995436 utr 5 prime probably benign
R0149:Olfr935 UTSW 9 38994584 missense probably benign 0.05
R1818:Olfr935 UTSW 9 38994606 missense possibly damaging 0.61
R2092:Olfr935 UTSW 9 38995189 missense probably damaging 1.00
R2151:Olfr935 UTSW 9 38994716 missense probably damaging 1.00
R2166:Olfr935 UTSW 9 38995217 nonsense probably null
R2347:Olfr935 UTSW 9 38994509 makesense probably null
R4404:Olfr935 UTSW 9 38994569 missense possibly damaging 0.77
R4406:Olfr935 UTSW 9 38994569 missense possibly damaging 0.77
R5152:Olfr935 UTSW 9 38995177 missense possibly damaging 0.88
R5467:Olfr935 UTSW 9 38994904 missense probably benign 0.14
R5509:Olfr935 UTSW 9 38994628 missense probably benign 0.03
R5954:Olfr935 UTSW 9 38995415 missense probably damaging 1.00
R6647:Olfr935 UTSW 9 38994914 missense possibly damaging 0.55
R6680:Olfr935 UTSW 9 38994658 missense probably damaging 1.00
R6928:Olfr935 UTSW 9 38994632 missense probably benign 0.03
R7242:Olfr935 UTSW 9 38995141 missense probably benign 0.31
R7271:Olfr935 UTSW 9 38994657 nonsense probably null
R7309:Olfr935 UTSW 9 38995280 missense probably damaging 1.00
R7775:Olfr935 UTSW 9 38994907 missense probably damaging 1.00
R7778:Olfr935 UTSW 9 38994907 missense probably damaging 1.00
R7866:Olfr935 UTSW 9 38994731 missense not run
R8280:Olfr935 UTSW 9 38994779 missense probably benign
R8334:Olfr935 UTSW 9 38994593 missense probably benign 0.00
R8841:Olfr935 UTSW 9 38994583 missense possibly damaging 0.95
R9161:Olfr935 UTSW 9 38994520 missense possibly damaging 0.70
R9169:Olfr935 UTSW 9 38995277 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCTGCCCTCAGTGGATTTAATGCG -3'
(R):5'- CTTCCTCTCTGGCTTAACAGAACAACC -3'

Sequencing Primer
(F):5'- TGAGCTGATGCACAAACTATGC -3'
(R):5'- TGGCTTAACAGAACAACCAGAAC -3'
Posted On 2013-05-23