Incidental Mutation 'R4953:Dock1'
ID381394
Institutional Source Beutler Lab
Gene Symbol Dock1
Ensembl Gene ENSMUSG00000058325
Gene Namededicator of cytokinesis 1
SynonymsD630004B07Rik, Dock180, 9130006G06Rik
MMRRC Submission 042550-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4953 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location134670654-135173639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135152288 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1598 (E1598G)
Ref Sequence ENSEMBL: ENSMUSP00000081531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084488]
PDB Structure
Solution structure of the SH3 domain of DOCK180 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000084488
AA Change: E1598G

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325
AA Change: E1598G

DomainStartEndE-ValueType
SH3 12 69 7.57e-17 SMART
Pfam:DOCK_N 72 416 1.7e-113 PFAM
Pfam:DOCK-C2 421 618 1.2e-61 PFAM
low complexity region 628 639 N/A INTRINSIC
Pfam:DHR-2 1111 1610 3.3e-102 PFAM
low complexity region 1639 1664 N/A INTRINSIC
low complexity region 1683 1701 N/A INTRINSIC
low complexity region 1756 1773 N/A INTRINSIC
low complexity region 1823 1857 N/A INTRINSIC
Meta Mutation Damage Score 0.1489 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Dedicator of cytokinesis proteins act as guanine nucleotide exchange factors for small Rho family G proteins. The encoded protein regulates the small GTPase Rac, thereby influencing several biological processes, including phagocytosis and cell migration. Overexpression of this gene has also been associated with certain cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with abnormal muscle development and failure of lungs to inflate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,074,376 Y129H probably damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Adgre1 G A 17: 57,441,321 G507E probably damaging Het
Agpat5 G A 8: 18,868,955 V118I probably benign Het
Aif1 T C 17: 35,171,098 probably null Het
Akr1c6 A T 13: 4,438,609 probably null Het
Akt2 T A 7: 27,638,172 probably null Het
Ankrd35 T A 3: 96,683,673 L425Q possibly damaging Het
Arhgap40 A G 2: 158,543,406 T520A possibly damaging Het
Arhgef28 T A 13: 97,929,554 D1597V possibly damaging Het
Aspm A G 1: 139,471,734 D1079G probably benign Het
Atp1a2 A T 1: 172,291,442 probably benign Het
Cage1 C A 13: 38,023,430 E252D possibly damaging Het
Ccdc185 A G 1: 182,749,017 S36P possibly damaging Het
Cd300a T C 11: 114,893,421 V85A probably damaging Het
Cd38 A C 5: 43,907,545 D235A possibly damaging Het
Cdcp1 T C 9: 123,180,023 K530R probably benign Het
Ceacam20 T A 7: 19,971,726 L214Q probably damaging Het
Cntn4 G A 6: 106,525,418 A379T probably benign Het
Col4a2 A T 8: 11,429,505 E796V probably benign Het
Copa A G 1: 172,082,886 probably benign Het
Cpa5 A G 6: 30,631,364 T426A possibly damaging Het
Csmd1 A G 8: 16,199,917 F1016L probably damaging Het
Cyb5r3 A T 15: 83,158,621 L290* probably null Het
Ddx42 A G 11: 106,242,940 T581A probably damaging Het
Deaf1 C T 7: 141,322,468 G221S probably damaging Het
Dnah6 A G 6: 73,188,383 S580P probably benign Het
Drg2 T C 11: 60,459,436 probably benign Het
Eif3f C A 7: 108,934,640 probably benign Het
Fam184a G T 10: 53,698,805 T236K probably benign Het
Gas7 C T 11: 67,660,050 T126M possibly damaging Het
Gckr T G 5: 31,308,264 F408C probably damaging Het
Gm17472 A G 6: 42,981,070 D91G probably damaging Het
Gm5117 G A 8: 31,738,580 noncoding transcript Het
Gsto1 T A 19: 47,855,320 I47N probably damaging Het
Hck C T 2: 153,134,677 P244S probably damaging Het
Hif3a T C 7: 17,050,565 T250A probably damaging Het
Hmcn1 A T 1: 150,876,360 probably benign Het
Impa1 G A 3: 10,315,280 S247F probably damaging Het
Ints14 G C 9: 64,982,058 R397P probably damaging Het
Iqgap1 T C 7: 80,723,776 probably null Het
Krt2 T C 15: 101,813,942 K436R probably damaging Het
Lama3 G A 18: 12,448,305 C607Y probably damaging Het
Loxl4 G T 19: 42,610,694 probably benign Het
Lrrc8d C T 5: 105,813,368 T548M probably damaging Het
Man1b1 T A 2: 25,338,184 D155E probably damaging Het
Mapk8ip2 C T 15: 89,457,228 P214L probably benign Het
Mast1 G A 8: 84,918,728 T696I probably damaging Het
Muc15 C T 2: 110,731,272 P18S probably damaging Het
Mybl2 T C 2: 163,080,796 S205P probably damaging Het
Mylk T C 16: 34,988,961 S1763P probably damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nfib A G 4: 82,353,571 M252T probably benign Het
Nid2 C A 14: 19,778,078 Y261* probably null Het
Nmd3 C T 3: 69,731,637 R187C possibly damaging Het
Nomo1 G T 7: 46,050,731 probably benign Het
Npy4r A G 14: 34,146,480 F284L probably damaging Het
Nt5dc2 T C 14: 31,138,921 V351A possibly damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1480 T A 19: 13,529,814 L91Q probably null Het
Olfr996 T A 2: 85,579,725 L162* probably null Het
Pcdhb12 T A 18: 37,436,156 D118E probably damaging Het
Pdcd11 C T 19: 47,127,965 T1518I probably benign Het
Pde6a T A 18: 61,231,362 C163* probably null Het
Pign A T 1: 105,644,502 W314R probably benign Het
Pip5k1b T A 19: 24,390,435 H76L probably damaging Het
Plcz1 T C 6: 140,028,551 N55S possibly damaging Het
Pou5f1 A T 17: 35,510,541 H350L possibly damaging Het
Rchy1 A T 5: 91,962,628 probably null Het
Ric8b A G 10: 84,958,082 T270A possibly damaging Het
Rprml A G 11: 103,649,818 E13G probably benign Het
Secisbp2 T A 13: 51,682,027 I719N probably damaging Het
Sergef C T 7: 46,633,835 R148H probably benign Het
Serpina6 T A 12: 103,651,962 probably null Het
Sirpb1b C A 3: 15,548,827 W65L probably damaging Het
Slc32a1 A T 2: 158,614,057 I211F possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Smarce1 A G 11: 99,215,151 V226A probably benign Het
Spata31d1b A T 13: 59,716,283 E415V probably damaging Het
Speg G A 1: 75,423,864 R2556H possibly damaging Het
Suclg2 A C 6: 95,566,436 V338G probably damaging Het
Tarbp1 T C 8: 126,447,445 E874G possibly damaging Het
Tex14 G T 11: 87,536,901 probably null Het
Trim36 T A 18: 46,196,178 D53V possibly damaging Het
Tsga10ip T A 19: 5,394,340 Y21F possibly damaging Het
Ttn C T 2: 76,789,945 V15849M probably damaging Het
Ube3b T C 5: 114,401,410 S421P probably benign Het
Unc5a A T 13: 54,999,870 M498L probably benign Het
Vipr2 A G 12: 116,144,256 I420M probably benign Het
Vmn1r179 T A 7: 23,929,090 H235Q probably damaging Het
Vps35 T A 8: 85,281,846 I267F probably damaging Het
Wdr26 G A 1: 181,197,651 R279W probably damaging Het
Xpo6 C A 7: 126,169,271 R88L probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp105 T A 9: 122,929,815 S184T probably benign Het
Zfp574 G A 7: 25,080,963 R470H probably damaging Het
Zswim9 T A 7: 13,269,558 H122L probably damaging Het
Other mutations in Dock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Dock1 APN 7 135146531 splice site probably benign
IGL01319:Dock1 APN 7 134789278 missense probably benign
IGL01390:Dock1 APN 7 134745047 missense possibly damaging 0.95
IGL01394:Dock1 APN 7 134766216 missense probably benign 0.01
IGL01489:Dock1 APN 7 134999321 splice site probably benign
IGL01505:Dock1 APN 7 135158510 missense possibly damaging 0.91
IGL01586:Dock1 APN 7 134753377 missense probably damaging 1.00
IGL01637:Dock1 APN 7 135137813 critical splice acceptor site probably null
IGL01649:Dock1 APN 7 134777410 missense probably damaging 1.00
IGL01652:Dock1 APN 7 134777497 splice site probably benign
IGL01859:Dock1 APN 7 135077161 missense possibly damaging 0.51
IGL02068:Dock1 APN 7 134771548 missense probably benign 0.26
IGL02168:Dock1 APN 7 135077131 splice site probably benign
IGL02200:Dock1 APN 7 134744271 missense probably benign 0.01
IGL02244:Dock1 APN 7 134777445 nonsense probably null
IGL02285:Dock1 APN 7 135081920 critical splice donor site probably null
IGL02319:Dock1 APN 7 134772449 missense possibly damaging 0.94
IGL02334:Dock1 APN 7 135145565 missense probably damaging 1.00
IGL02338:Dock1 APN 7 135133075 missense possibly damaging 0.95
IGL02351:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02358:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02607:Dock1 APN 7 134851513 missense probably benign 0.13
IGL02638:Dock1 APN 7 135146480 missense probably benign 0.09
IGL02724:Dock1 APN 7 135163353 missense probably benign
IGL02820:Dock1 APN 7 135167215 missense probably benign 0.11
IGL02950:Dock1 APN 7 134730024 missense probably damaging 1.00
IGL02993:Dock1 APN 7 134744298 missense probably benign
IGL03000:Dock1 APN 7 134789240 missense probably benign 0.17
IGL03092:Dock1 APN 7 134765216 splice site probably benign
IGL03131:Dock1 APN 7 134874183 missense possibly damaging 0.80
IGL03136:Dock1 APN 7 135168389 missense probably benign 0.00
IGL03210:Dock1 APN 7 134756939 missense possibly damaging 0.62
IGL03220:Dock1 APN 7 135108522 critical splice donor site probably null
P0028:Dock1 UTSW 7 134999324 splice site probably benign
PIT4453001:Dock1 UTSW 7 135152300 missense probably benign
R0003:Dock1 UTSW 7 134730064 splice site probably benign
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0179:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0180:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0347:Dock1 UTSW 7 134763867 missense probably damaging 1.00
R0399:Dock1 UTSW 7 135163442 missense probably benign 0.00
R0457:Dock1 UTSW 7 135138145 missense possibly damaging 0.90
R0480:Dock1 UTSW 7 134737718 missense probably damaging 1.00
R0521:Dock1 UTSW 7 135143778 missense probably benign 0.21
R0792:Dock1 UTSW 7 134874150 missense probably benign 0.02
R1136:Dock1 UTSW 7 134848173 missense possibly damaging 0.95
R1224:Dock1 UTSW 7 135108819 missense possibly damaging 0.67
R1267:Dock1 UTSW 7 134746436 missense probably damaging 1.00
R1373:Dock1 UTSW 7 135167175 missense probably benign 0.01
R1401:Dock1 UTSW 7 135133936 nonsense probably null
R1454:Dock1 UTSW 7 134851609 splice site probably benign
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1523:Dock1 UTSW 7 134744247 missense possibly damaging 0.49
R1643:Dock1 UTSW 7 135098779 missense probably damaging 1.00
R1659:Dock1 UTSW 7 134789243 missense probably damaging 0.98
R1793:Dock1 UTSW 7 135098727 splice site probably null
R1864:Dock1 UTSW 7 135146507 missense probably benign 0.07
R1911:Dock1 UTSW 7 134999300 missense probably damaging 1.00
R2567:Dock1 UTSW 7 135145484 missense probably damaging 1.00
R3816:Dock1 UTSW 7 134744286 nonsense probably null
R3971:Dock1 UTSW 7 134746908 missense probably damaging 1.00
R4063:Dock1 UTSW 7 135115292 missense possibly damaging 0.81
R4163:Dock1 UTSW 7 134744322 missense possibly damaging 0.79
R4271:Dock1 UTSW 7 134734054 missense probably damaging 0.99
R4684:Dock1 UTSW 7 134724409 nonsense probably null
R4717:Dock1 UTSW 7 134848170 missense probably damaging 1.00
R4725:Dock1 UTSW 7 134745014 nonsense probably null
R4788:Dock1 UTSW 7 135145484 missense probably damaging 0.98
R4869:Dock1 UTSW 7 134734071 missense probably damaging 1.00
R4889:Dock1 UTSW 7 134744976 missense probably benign 0.02
R5031:Dock1 UTSW 7 135152246 missense probably benign 0.02
R5161:Dock1 UTSW 7 134734062 missense possibly damaging 0.69
R5168:Dock1 UTSW 7 135118908 missense probably damaging 1.00
R5212:Dock1 UTSW 7 134789194 missense possibly damaging 0.68
R5648:Dock1 UTSW 7 134746954 missense probably damaging 1.00
R5685:Dock1 UTSW 7 134772362 missense probably benign 0.19
R5834:Dock1 UTSW 7 134763933 missense probably damaging 1.00
R6181:Dock1 UTSW 7 135158522 missense probably damaging 1.00
R6334:Dock1 UTSW 7 134851576 missense probably benign 0.01
R6406:Dock1 UTSW 7 135145486 missense probably benign 0.26
R6425:Dock1 UTSW 7 135163381 missense possibly damaging 0.79
R6489:Dock1 UTSW 7 134990541 missense probably damaging 0.99
R6616:Dock1 UTSW 7 135108492 missense possibly damaging 0.85
R6706:Dock1 UTSW 7 135133886 missense possibly damaging 0.72
R6766:Dock1 UTSW 7 134756793 intron probably null
R6861:Dock1 UTSW 7 134771478 missense probably benign 0.00
R6985:Dock1 UTSW 7 135163403 missense possibly damaging 0.95
R7259:Dock1 UTSW 7 134782748 missense probably damaging 0.99
R7285:Dock1 UTSW 7 134745008 missense probably benign 0.01
R7471:Dock1 UTSW 7 135163343 missense possibly damaging 0.65
R7497:Dock1 UTSW 7 134765274 missense probably benign
R7691:Dock1 UTSW 7 135138157 critical splice donor site probably null
R7732:Dock1 UTSW 7 134744970 missense probably benign 0.01
R7818:Dock1 UTSW 7 134763865 missense probably damaging 1.00
X0062:Dock1 UTSW 7 135108451 missense probably damaging 1.00
Z1088:Dock1 UTSW 7 134804547 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCTGATTTGGGAACAGAAGCAG -3'
(R):5'- GCACACTACTCAGAGACGATG -3'

Sequencing Primer
(F):5'- ACAGAAGCAGGTGCAACC -3'
(R):5'- GAGGTACTTGGAAATTAACAACTCCC -3'
Posted On2016-04-27