Incidental Mutation 'R4953:Vps35'
ID381401
Institutional Source Beutler Lab
Gene Symbol Vps35
Ensembl Gene ENSMUSG00000031696
Gene NameVPS35 retromer complex component
SynonymsMem3
MMRRC Submission 042550-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4953 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85260392-85299802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85281846 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 267 (I267F)
Ref Sequence ENSEMBL: ENSMUSP00000034131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034131]
Predicted Effect probably damaging
Transcript: ENSMUST00000034131
AA Change: I267F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034131
Gene: ENSMUSG00000031696
AA Change: I267F

DomainStartEndE-ValueType
Pfam:Vps35 15 753 6.8e-303 PFAM
Meta Mutation Damage Score 0.9081 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,074,376 Y129H probably damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Adgre1 G A 17: 57,441,321 G507E probably damaging Het
Agpat5 G A 8: 18,868,955 V118I probably benign Het
Aif1 T C 17: 35,171,098 probably null Het
Akr1c6 A T 13: 4,438,609 probably null Het
Akt2 T A 7: 27,638,172 probably null Het
Ankrd35 T A 3: 96,683,673 L425Q possibly damaging Het
Arhgap40 A G 2: 158,543,406 T520A possibly damaging Het
Arhgef28 T A 13: 97,929,554 D1597V possibly damaging Het
Aspm A G 1: 139,471,734 D1079G probably benign Het
Atp1a2 A T 1: 172,291,442 probably benign Het
Cage1 C A 13: 38,023,430 E252D possibly damaging Het
Ccdc185 A G 1: 182,749,017 S36P possibly damaging Het
Cd300a T C 11: 114,893,421 V85A probably damaging Het
Cd38 A C 5: 43,907,545 D235A possibly damaging Het
Cdcp1 T C 9: 123,180,023 K530R probably benign Het
Ceacam20 T A 7: 19,971,726 L214Q probably damaging Het
Cntn4 G A 6: 106,525,418 A379T probably benign Het
Col4a2 A T 8: 11,429,505 E796V probably benign Het
Copa A G 1: 172,082,886 probably benign Het
Cpa5 A G 6: 30,631,364 T426A possibly damaging Het
Csmd1 A G 8: 16,199,917 F1016L probably damaging Het
Cyb5r3 A T 15: 83,158,621 L290* probably null Het
Ddx42 A G 11: 106,242,940 T581A probably damaging Het
Deaf1 C T 7: 141,322,468 G221S probably damaging Het
Dnah6 A G 6: 73,188,383 S580P probably benign Het
Dock1 A G 7: 135,152,288 E1598G probably benign Het
Drg2 T C 11: 60,459,436 probably benign Het
Eif3f C A 7: 108,934,640 probably benign Het
Fam184a G T 10: 53,698,805 T236K probably benign Het
Gas7 C T 11: 67,660,050 T126M possibly damaging Het
Gckr T G 5: 31,308,264 F408C probably damaging Het
Gm17472 A G 6: 42,981,070 D91G probably damaging Het
Gm5117 G A 8: 31,738,580 noncoding transcript Het
Gsto1 T A 19: 47,855,320 I47N probably damaging Het
Hck C T 2: 153,134,677 P244S probably damaging Het
Hif3a T C 7: 17,050,565 T250A probably damaging Het
Hmcn1 A T 1: 150,876,360 probably benign Het
Impa1 G A 3: 10,315,280 S247F probably damaging Het
Ints14 G C 9: 64,982,058 R397P probably damaging Het
Iqgap1 T C 7: 80,723,776 probably null Het
Krt2 T C 15: 101,813,942 K436R probably damaging Het
Lama3 G A 18: 12,448,305 C607Y probably damaging Het
Loxl4 G T 19: 42,610,694 probably benign Het
Lrrc8d C T 5: 105,813,368 T548M probably damaging Het
Man1b1 T A 2: 25,338,184 D155E probably damaging Het
Mapk8ip2 C T 15: 89,457,228 P214L probably benign Het
Mast1 G A 8: 84,918,728 T696I probably damaging Het
Muc15 C T 2: 110,731,272 P18S probably damaging Het
Mybl2 T C 2: 163,080,796 S205P probably damaging Het
Mylk T C 16: 34,988,961 S1763P probably damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nfib A G 4: 82,353,571 M252T probably benign Het
Nid2 C A 14: 19,778,078 Y261* probably null Het
Nmd3 C T 3: 69,731,637 R187C possibly damaging Het
Nomo1 G T 7: 46,050,731 probably benign Het
Npy4r A G 14: 34,146,480 F284L probably damaging Het
Nt5dc2 T C 14: 31,138,921 V351A possibly damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1480 T A 19: 13,529,814 L91Q probably null Het
Olfr996 T A 2: 85,579,725 L162* probably null Het
Pcdhb12 T A 18: 37,436,156 D118E probably damaging Het
Pdcd11 C T 19: 47,127,965 T1518I probably benign Het
Pde6a T A 18: 61,231,362 C163* probably null Het
Pign A T 1: 105,644,502 W314R probably benign Het
Pip5k1b T A 19: 24,390,435 H76L probably damaging Het
Plcz1 T C 6: 140,028,551 N55S possibly damaging Het
Pou5f1 A T 17: 35,510,541 H350L possibly damaging Het
Rchy1 A T 5: 91,962,628 probably null Het
Ric8b A G 10: 84,958,082 T270A possibly damaging Het
Rprml A G 11: 103,649,818 E13G probably benign Het
Secisbp2 T A 13: 51,682,027 I719N probably damaging Het
Sergef C T 7: 46,633,835 R148H probably benign Het
Serpina6 T A 12: 103,651,962 probably null Het
Sirpb1b C A 3: 15,548,827 W65L probably damaging Het
Slc32a1 A T 2: 158,614,057 I211F possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Smarce1 A G 11: 99,215,151 V226A probably benign Het
Spata31d1b A T 13: 59,716,283 E415V probably damaging Het
Speg G A 1: 75,423,864 R2556H possibly damaging Het
Suclg2 A C 6: 95,566,436 V338G probably damaging Het
Tarbp1 T C 8: 126,447,445 E874G possibly damaging Het
Tex14 G T 11: 87,536,901 probably null Het
Trim36 T A 18: 46,196,178 D53V possibly damaging Het
Tsga10ip T A 19: 5,394,340 Y21F possibly damaging Het
Ttn C T 2: 76,789,945 V15849M probably damaging Het
Ube3b T C 5: 114,401,410 S421P probably benign Het
Unc5a A T 13: 54,999,870 M498L probably benign Het
Vipr2 A G 12: 116,144,256 I420M probably benign Het
Vmn1r179 T A 7: 23,929,090 H235Q probably damaging Het
Wdr26 G A 1: 181,197,651 R279W probably damaging Het
Xpo6 C A 7: 126,169,271 R88L probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp105 T A 9: 122,929,815 S184T probably benign Het
Zfp574 G A 7: 25,080,963 R470H probably damaging Het
Zswim9 T A 7: 13,269,558 H122L probably damaging Het
Other mutations in Vps35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Vps35 APN 8 85273463 splice site probably benign
IGL02604:Vps35 APN 8 85286389 missense probably damaging 1.00
IGL03278:Vps35 APN 8 85294961 unclassified probably benign
IGL03326:Vps35 APN 8 85274897 nonsense probably null
PIT4151001:Vps35 UTSW 8 85284048 missense possibly damaging 0.95
R0118:Vps35 UTSW 8 85294953 missense probably benign 0.04
R0226:Vps35 UTSW 8 85273575 missense probably damaging 0.97
R1079:Vps35 UTSW 8 85279054 missense probably damaging 1.00
R1477:Vps35 UTSW 8 85287800 missense probably damaging 1.00
R1969:Vps35 UTSW 8 85278994 missense possibly damaging 0.90
R2082:Vps35 UTSW 8 85263465 missense possibly damaging 0.95
R2156:Vps35 UTSW 8 85286500 missense probably benign 0.06
R2341:Vps35 UTSW 8 85274814 splice site probably benign
R3752:Vps35 UTSW 8 85274831 missense probably benign 0.34
R4589:Vps35 UTSW 8 85287702 missense probably damaging 1.00
R4745:Vps35 UTSW 8 85261262 missense probably benign
R4790:Vps35 UTSW 8 85278857 splice site probably null
R4827:Vps35 UTSW 8 85273557 missense possibly damaging 0.94
R6277:Vps35 UTSW 8 85261228 missense possibly damaging 0.80
R6291:Vps35 UTSW 8 85299457 start codon destroyed probably benign 0.07
R6434:Vps35 UTSW 8 85273495 missense possibly damaging 0.53
R7175:Vps35 UTSW 8 85263560 splice site probably null
R7206:Vps35 UTSW 8 85287721 missense probably damaging 1.00
R7309:Vps35 UTSW 8 85274967 missense probably benign 0.05
R7479:Vps35 UTSW 8 85270805 missense probably benign 0.17
R7547:Vps35 UTSW 8 85263370 missense probably damaging 1.00
R7761:Vps35 UTSW 8 85284078 missense possibly damaging 0.91
R7812:Vps35 UTSW 8 85284189 missense probably benign 0.01
X0020:Vps35 UTSW 8 85263421 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATTTCCAGCATATAAGTAAGTC -3'
(R):5'- CTCCCACAGTGTAGAAGCTCTAG -3'

Sequencing Primer
(F):5'- TTCTGAGACAGAGTTTAGGCACGC -3'
(R):5'- GCACAAGGGAAATCTTCATAATCTTG -3'
Posted On2016-04-27