Incidental Mutation 'R4953:Tarbp1'
ID381403
Institutional Source Beutler Lab
Gene Symbol Tarbp1
Ensembl Gene ENSMUSG00000090290
Gene NameTAR RNA binding protein 1
SynonymsGm17296
MMRRC Submission 042550-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4953 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location126425329-126475065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126447445 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 874 (E874G)
Ref Sequence ENSEMBL: ENSMUSP00000129815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170518]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170518
AA Change: E874G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: E874G

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
low complexity region 77 97 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
SCOP:d1gw5a_ 1059 1260 3e-3 SMART
Pfam:SpoU_methylase 1421 1564 2.2e-32 PFAM
Meta Mutation Damage Score 0.1626 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,074,376 Y129H probably damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Adgre1 G A 17: 57,441,321 G507E probably damaging Het
Agpat5 G A 8: 18,868,955 V118I probably benign Het
Aif1 T C 17: 35,171,098 probably null Het
Akr1c6 A T 13: 4,438,609 probably null Het
Akt2 T A 7: 27,638,172 probably null Het
Ankrd35 T A 3: 96,683,673 L425Q possibly damaging Het
Arhgap40 A G 2: 158,543,406 T520A possibly damaging Het
Arhgef28 T A 13: 97,929,554 D1597V possibly damaging Het
Aspm A G 1: 139,471,734 D1079G probably benign Het
Atp1a2 A T 1: 172,291,442 probably benign Het
Cage1 C A 13: 38,023,430 E252D possibly damaging Het
Ccdc185 A G 1: 182,749,017 S36P possibly damaging Het
Cd300a T C 11: 114,893,421 V85A probably damaging Het
Cd38 A C 5: 43,907,545 D235A possibly damaging Het
Cdcp1 T C 9: 123,180,023 K530R probably benign Het
Ceacam20 T A 7: 19,971,726 L214Q probably damaging Het
Cntn4 G A 6: 106,525,418 A379T probably benign Het
Col4a2 A T 8: 11,429,505 E796V probably benign Het
Copa A G 1: 172,082,886 probably benign Het
Cpa5 A G 6: 30,631,364 T426A possibly damaging Het
Csmd1 A G 8: 16,199,917 F1016L probably damaging Het
Cyb5r3 A T 15: 83,158,621 L290* probably null Het
Ddx42 A G 11: 106,242,940 T581A probably damaging Het
Deaf1 C T 7: 141,322,468 G221S probably damaging Het
Dnah6 A G 6: 73,188,383 S580P probably benign Het
Dock1 A G 7: 135,152,288 E1598G probably benign Het
Drg2 T C 11: 60,459,436 probably benign Het
Eif3f C A 7: 108,934,640 probably benign Het
Fam184a G T 10: 53,698,805 T236K probably benign Het
Gas7 C T 11: 67,660,050 T126M possibly damaging Het
Gckr T G 5: 31,308,264 F408C probably damaging Het
Gm17472 A G 6: 42,981,070 D91G probably damaging Het
Gm5117 G A 8: 31,738,580 noncoding transcript Het
Gsto1 T A 19: 47,855,320 I47N probably damaging Het
Hck C T 2: 153,134,677 P244S probably damaging Het
Hif3a T C 7: 17,050,565 T250A probably damaging Het
Hmcn1 A T 1: 150,876,360 probably benign Het
Impa1 G A 3: 10,315,280 S247F probably damaging Het
Ints14 G C 9: 64,982,058 R397P probably damaging Het
Iqgap1 T C 7: 80,723,776 probably null Het
Krt2 T C 15: 101,813,942 K436R probably damaging Het
Lama3 G A 18: 12,448,305 C607Y probably damaging Het
Loxl4 G T 19: 42,610,694 probably benign Het
Lrrc8d C T 5: 105,813,368 T548M probably damaging Het
Man1b1 T A 2: 25,338,184 D155E probably damaging Het
Mapk8ip2 C T 15: 89,457,228 P214L probably benign Het
Mast1 G A 8: 84,918,728 T696I probably damaging Het
Muc15 C T 2: 110,731,272 P18S probably damaging Het
Mybl2 T C 2: 163,080,796 S205P probably damaging Het
Mylk T C 16: 34,988,961 S1763P probably damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nfib A G 4: 82,353,571 M252T probably benign Het
Nid2 C A 14: 19,778,078 Y261* probably null Het
Nmd3 C T 3: 69,731,637 R187C possibly damaging Het
Nomo1 G T 7: 46,050,731 probably benign Het
Npy4r A G 14: 34,146,480 F284L probably damaging Het
Nt5dc2 T C 14: 31,138,921 V351A possibly damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1480 T A 19: 13,529,814 L91Q probably null Het
Olfr996 T A 2: 85,579,725 L162* probably null Het
Pcdhb12 T A 18: 37,436,156 D118E probably damaging Het
Pdcd11 C T 19: 47,127,965 T1518I probably benign Het
Pde6a T A 18: 61,231,362 C163* probably null Het
Pign A T 1: 105,644,502 W314R probably benign Het
Pip5k1b T A 19: 24,390,435 H76L probably damaging Het
Plcz1 T C 6: 140,028,551 N55S possibly damaging Het
Pou5f1 A T 17: 35,510,541 H350L possibly damaging Het
Rchy1 A T 5: 91,962,628 probably null Het
Ric8b A G 10: 84,958,082 T270A possibly damaging Het
Rprml A G 11: 103,649,818 E13G probably benign Het
Secisbp2 T A 13: 51,682,027 I719N probably damaging Het
Sergef C T 7: 46,633,835 R148H probably benign Het
Serpina6 T A 12: 103,651,962 probably null Het
Sirpb1b C A 3: 15,548,827 W65L probably damaging Het
Slc32a1 A T 2: 158,614,057 I211F possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Smarce1 A G 11: 99,215,151 V226A probably benign Het
Spata31d1b A T 13: 59,716,283 E415V probably damaging Het
Speg G A 1: 75,423,864 R2556H possibly damaging Het
Suclg2 A C 6: 95,566,436 V338G probably damaging Het
Tex14 G T 11: 87,536,901 probably null Het
Trim36 T A 18: 46,196,178 D53V possibly damaging Het
Tsga10ip T A 19: 5,394,340 Y21F possibly damaging Het
Ttn C T 2: 76,789,945 V15849M probably damaging Het
Ube3b T C 5: 114,401,410 S421P probably benign Het
Unc5a A T 13: 54,999,870 M498L probably benign Het
Vipr2 A G 12: 116,144,256 I420M probably benign Het
Vmn1r179 T A 7: 23,929,090 H235Q probably damaging Het
Vps35 T A 8: 85,281,846 I267F probably damaging Het
Wdr26 G A 1: 181,197,651 R279W probably damaging Het
Xpo6 C A 7: 126,169,271 R88L probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp105 T A 9: 122,929,815 S184T probably benign Het
Zfp574 G A 7: 25,080,963 R470H probably damaging Het
Zswim9 T A 7: 13,269,558 H122L probably damaging Het
Other mutations in Tarbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tarbp1 APN 8 126459161 missense probably damaging 1.00
IGL01419:Tarbp1 APN 8 126428155 missense probably benign 0.03
IGL01475:Tarbp1 APN 8 126433962 missense probably benign 0.03
IGL01688:Tarbp1 APN 8 126447551 missense probably damaging 1.00
IGL01772:Tarbp1 APN 8 126447231 splice site probably benign
IGL02402:Tarbp1 APN 8 126450828 splice site probably benign
IGL02899:Tarbp1 APN 8 126453844 missense probably damaging 0.96
IGL03006:Tarbp1 APN 8 126444142 missense probably damaging 1.00
IGL03273:Tarbp1 APN 8 126453835 missense probably damaging 1.00
PIT4280001:Tarbp1 UTSW 8 126430847 missense probably damaging 0.96
R0048:Tarbp1 UTSW 8 126447530 missense probably damaging 1.00
R0309:Tarbp1 UTSW 8 126438928 splice site probably benign
R0383:Tarbp1 UTSW 8 126447484 missense probably benign 0.00
R0455:Tarbp1 UTSW 8 126440873 missense probably benign 0.00
R0738:Tarbp1 UTSW 8 126438801 critical splice donor site probably null
R1345:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1370:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1617:Tarbp1 UTSW 8 126444268 missense possibly damaging 0.47
R1628:Tarbp1 UTSW 8 126430860 missense possibly damaging 0.78
R1702:Tarbp1 UTSW 8 126428218 missense probably damaging 1.00
R1873:Tarbp1 UTSW 8 126447047 missense probably damaging 1.00
R2018:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2019:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2060:Tarbp1 UTSW 8 126447594 splice site probably null
R2877:Tarbp1 UTSW 8 126427832 missense probably damaging 1.00
R3008:Tarbp1 UTSW 8 126447421 missense possibly damaging 0.46
R3875:Tarbp1 UTSW 8 126438799 splice site probably benign
R3905:Tarbp1 UTSW 8 126428152 missense probably damaging 1.00
R3923:Tarbp1 UTSW 8 126440771 missense probably benign 0.00
R4420:Tarbp1 UTSW 8 126447080 missense possibly damaging 0.59
R4570:Tarbp1 UTSW 8 126452233 missense probably benign 0.00
R4610:Tarbp1 UTSW 8 126474330 missense probably damaging 1.00
R4649:Tarbp1 UTSW 8 126447195 missense probably damaging 0.96
R4802:Tarbp1 UTSW 8 126474889 missense possibly damaging 0.75
R4951:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R5254:Tarbp1 UTSW 8 126467156 missense probably damaging 0.96
R5255:Tarbp1 UTSW 8 126428970 missense probably benign 0.16
R5638:Tarbp1 UTSW 8 126450686 missense probably damaging 1.00
R5696:Tarbp1 UTSW 8 126447340 missense probably damaging 0.98
R5707:Tarbp1 UTSW 8 126467144 missense probably damaging 1.00
R5896:Tarbp1 UTSW 8 126452928 missense probably benign 0.05
R6087:Tarbp1 UTSW 8 126428970 missense probably benign 0.00
R6117:Tarbp1 UTSW 8 126427541 missense probably benign 0.00
R6132:Tarbp1 UTSW 8 126434809 missense probably benign 0.17
R6168:Tarbp1 UTSW 8 126448405 missense possibly damaging 0.89
R6419:Tarbp1 UTSW 8 126459044 missense possibly damaging 0.95
R6482:Tarbp1 UTSW 8 126450695 missense probably benign 0.01
R6766:Tarbp1 UTSW 8 126447400 missense probably benign 0.41
R6775:Tarbp1 UTSW 8 126436829 missense probably benign 0.16
R6960:Tarbp1 UTSW 8 126429039 missense possibly damaging 0.88
R7054:Tarbp1 UTSW 8 126474495 missense possibly damaging 0.85
R7068:Tarbp1 UTSW 8 126427034 missense probably damaging 1.00
R7454:Tarbp1 UTSW 8 126457677 missense probably benign 0.19
R7519:Tarbp1 UTSW 8 126433900 missense possibly damaging 0.87
R7760:Tarbp1 UTSW 8 126452807 missense not run
R7837:Tarbp1 UTSW 8 126474561 missense probably benign 0.00
R7882:Tarbp1 UTSW 8 126456493 missense probably damaging 1.00
R7982:Tarbp1 UTSW 8 126444301 missense probably damaging 1.00
R8166:Tarbp1 UTSW 8 126427128 missense possibly damaging 0.79
R8517:Tarbp1 UTSW 8 126444195 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ACAGTGTCAATCTCCACCGC -3'
(R):5'- GCCCCATATGCCAAAGAAGTG -3'

Sequencing Primer
(F):5'- TCCACCGCAACACTGTTG -3'
(R):5'- AGTTGGGAAACTGAGCCTTAGTATC -3'
Posted On2016-04-27