Incidental Mutation 'R4953:Tex14'
ID381413
Institutional Source Beutler Lab
Gene Symbol Tex14
Ensembl Gene ENSMUSG00000010342
Gene Nametestis expressed gene 14
Synonyms
MMRRC Submission 042550-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R4953 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87405065-87555823 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 87536901 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060835] [ENSMUST00000100657] [ENSMUST00000131973]
Predicted Effect probably null
Transcript: ENSMUST00000060835
SMART Domains Protein: ENSMUSP00000054444
Gene: ENSMUSG00000010342

DomainStartEndE-ValueType
ANK 22 51 7.99e2 SMART
ANK 55 84 6.36e-3 SMART
ANK 88 117 3.49e0 SMART
Pfam:Pkinase 251 504 3.5e-19 PFAM
Pfam:Pkinase_Tyr 254 503 8.1e-28 PFAM
coiled coil region 659 684 N/A INTRINSIC
coiled coil region 740 776 N/A INTRINSIC
low complexity region 1219 1236 N/A INTRINSIC
coiled coil region 1289 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100657
Predicted Effect probably null
Transcript: ENSMUST00000131973
SMART Domains Protein: ENSMUSP00000117564
Gene: ENSMUSG00000010342

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
Meta Mutation Damage Score 0.9482 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is necessary for intercellular bridges in germ cells, which are required for spermatogenesis. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Males homozygous for a targeted allele are infertile due to spermatogenic failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,074,376 Y129H probably damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Adgre1 G A 17: 57,441,321 G507E probably damaging Het
Agpat5 G A 8: 18,868,955 V118I probably benign Het
Aif1 T C 17: 35,171,098 probably null Het
Akr1c6 A T 13: 4,438,609 probably null Het
Akt2 T A 7: 27,638,172 probably null Het
Ankrd35 T A 3: 96,683,673 L425Q possibly damaging Het
Arhgap40 A G 2: 158,543,406 T520A possibly damaging Het
Arhgef28 T A 13: 97,929,554 D1597V possibly damaging Het
Aspm A G 1: 139,471,734 D1079G probably benign Het
Atp1a2 A T 1: 172,291,442 probably benign Het
Cage1 C A 13: 38,023,430 E252D possibly damaging Het
Ccdc185 A G 1: 182,749,017 S36P possibly damaging Het
Cd300a T C 11: 114,893,421 V85A probably damaging Het
Cd38 A C 5: 43,907,545 D235A possibly damaging Het
Cdcp1 T C 9: 123,180,023 K530R probably benign Het
Ceacam20 T A 7: 19,971,726 L214Q probably damaging Het
Cntn4 G A 6: 106,525,418 A379T probably benign Het
Col4a2 A T 8: 11,429,505 E796V probably benign Het
Copa A G 1: 172,082,886 probably benign Het
Cpa5 A G 6: 30,631,364 T426A possibly damaging Het
Csmd1 A G 8: 16,199,917 F1016L probably damaging Het
Cyb5r3 A T 15: 83,158,621 L290* probably null Het
Ddx42 A G 11: 106,242,940 T581A probably damaging Het
Deaf1 C T 7: 141,322,468 G221S probably damaging Het
Dnah6 A G 6: 73,188,383 S580P probably benign Het
Dock1 A G 7: 135,152,288 E1598G probably benign Het
Drg2 T C 11: 60,459,436 probably benign Het
Eif3f C A 7: 108,934,640 probably benign Het
Fam184a G T 10: 53,698,805 T236K probably benign Het
Gas7 C T 11: 67,660,050 T126M possibly damaging Het
Gckr T G 5: 31,308,264 F408C probably damaging Het
Gm17472 A G 6: 42,981,070 D91G probably damaging Het
Gm5117 G A 8: 31,738,580 noncoding transcript Het
Gsto1 T A 19: 47,855,320 I47N probably damaging Het
Hck C T 2: 153,134,677 P244S probably damaging Het
Hif3a T C 7: 17,050,565 T250A probably damaging Het
Hmcn1 A T 1: 150,876,360 probably benign Het
Impa1 G A 3: 10,315,280 S247F probably damaging Het
Ints14 G C 9: 64,982,058 R397P probably damaging Het
Iqgap1 T C 7: 80,723,776 probably null Het
Krt2 T C 15: 101,813,942 K436R probably damaging Het
Lama3 G A 18: 12,448,305 C607Y probably damaging Het
Loxl4 G T 19: 42,610,694 probably benign Het
Lrrc8d C T 5: 105,813,368 T548M probably damaging Het
Man1b1 T A 2: 25,338,184 D155E probably damaging Het
Mapk8ip2 C T 15: 89,457,228 P214L probably benign Het
Mast1 G A 8: 84,918,728 T696I probably damaging Het
Muc15 C T 2: 110,731,272 P18S probably damaging Het
Mybl2 T C 2: 163,080,796 S205P probably damaging Het
Mylk T C 16: 34,988,961 S1763P probably damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nfib A G 4: 82,353,571 M252T probably benign Het
Nid2 C A 14: 19,778,078 Y261* probably null Het
Nmd3 C T 3: 69,731,637 R187C possibly damaging Het
Nomo1 G T 7: 46,050,731 probably benign Het
Npy4r A G 14: 34,146,480 F284L probably damaging Het
Nt5dc2 T C 14: 31,138,921 V351A possibly damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1480 T A 19: 13,529,814 L91Q probably null Het
Olfr996 T A 2: 85,579,725 L162* probably null Het
Pcdhb12 T A 18: 37,436,156 D118E probably damaging Het
Pdcd11 C T 19: 47,127,965 T1518I probably benign Het
Pde6a T A 18: 61,231,362 C163* probably null Het
Pign A T 1: 105,644,502 W314R probably benign Het
Pip5k1b T A 19: 24,390,435 H76L probably damaging Het
Plcz1 T C 6: 140,028,551 N55S possibly damaging Het
Pou5f1 A T 17: 35,510,541 H350L possibly damaging Het
Rchy1 A T 5: 91,962,628 probably null Het
Ric8b A G 10: 84,958,082 T270A possibly damaging Het
Rprml A G 11: 103,649,818 E13G probably benign Het
Secisbp2 T A 13: 51,682,027 I719N probably damaging Het
Sergef C T 7: 46,633,835 R148H probably benign Het
Serpina6 T A 12: 103,651,962 probably null Het
Sirpb1b C A 3: 15,548,827 W65L probably damaging Het
Slc32a1 A T 2: 158,614,057 I211F possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Smarce1 A G 11: 99,215,151 V226A probably benign Het
Spata31d1b A T 13: 59,716,283 E415V probably damaging Het
Speg G A 1: 75,423,864 R2556H possibly damaging Het
Suclg2 A C 6: 95,566,436 V338G probably damaging Het
Tarbp1 T C 8: 126,447,445 E874G possibly damaging Het
Trim36 T A 18: 46,196,178 D53V possibly damaging Het
Tsga10ip T A 19: 5,394,340 Y21F possibly damaging Het
Ttn C T 2: 76,789,945 V15849M probably damaging Het
Ube3b T C 5: 114,401,410 S421P probably benign Het
Unc5a A T 13: 54,999,870 M498L probably benign Het
Vipr2 A G 12: 116,144,256 I420M probably benign Het
Vmn1r179 T A 7: 23,929,090 H235Q probably damaging Het
Vps35 T A 8: 85,281,846 I267F probably damaging Het
Wdr26 G A 1: 181,197,651 R279W probably damaging Het
Xpo6 C A 7: 126,169,271 R88L probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp105 T A 9: 122,929,815 S184T probably benign Het
Zfp574 G A 7: 25,080,963 R470H probably damaging Het
Zswim9 T A 7: 13,269,558 H122L probably damaging Het
Other mutations in Tex14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tex14 APN 11 87535643 missense probably damaging 0.98
IGL00494:Tex14 APN 11 87555484 missense probably damaging 1.00
IGL01604:Tex14 APN 11 87509698 missense possibly damaging 0.63
IGL02690:Tex14 APN 11 87486274 missense probably benign 0.11
IGL02888:Tex14 APN 11 87527912 critical splice donor site probably null
IGL03073:Tex14 APN 11 87535609 missense probably damaging 0.99
IGL03109:Tex14 APN 11 87543365 missense probably damaging 1.00
IGL03047:Tex14 UTSW 11 87536704 missense probably damaging 1.00
R0141:Tex14 UTSW 11 87493031 splice site probably null
R0455:Tex14 UTSW 11 87514305 missense possibly damaging 0.93
R0624:Tex14 UTSW 11 87520699 missense probably benign 0.19
R0718:Tex14 UTSW 11 87499613 missense probably benign 0.20
R1077:Tex14 UTSW 11 87519745 splice site probably benign
R1118:Tex14 UTSW 11 87522517 missense probably benign 0.07
R1120:Tex14 UTSW 11 87538676 splice site probably benign
R1168:Tex14 UTSW 11 87536742 missense probably benign 0.11
R1190:Tex14 UTSW 11 87495108 intron probably null
R1470:Tex14 UTSW 11 87549529 splice site probably benign
R1563:Tex14 UTSW 11 87536808 missense probably damaging 0.99
R1607:Tex14 UTSW 11 87554928 missense probably damaging 1.00
R1696:Tex14 UTSW 11 87511545 missense possibly damaging 0.49
R1873:Tex14 UTSW 11 87499605 missense probably damaging 1.00
R1894:Tex14 UTSW 11 87474448 missense probably damaging 1.00
R1911:Tex14 UTSW 11 87495035 missense probably damaging 1.00
R1955:Tex14 UTSW 11 87509621 missense probably damaging 1.00
R1971:Tex14 UTSW 11 87511605 missense probably damaging 1.00
R1990:Tex14 UTSW 11 87549470 missense probably damaging 1.00
R1991:Tex14 UTSW 11 87549470 missense probably damaging 1.00
R1993:Tex14 UTSW 11 87536755 missense possibly damaging 0.57
R2106:Tex14 UTSW 11 87486250 missense possibly damaging 0.47
R2118:Tex14 UTSW 11 87519743 splice site probably benign
R2860:Tex14 UTSW 11 87474417 missense probably damaging 1.00
R2861:Tex14 UTSW 11 87474417 missense probably damaging 1.00
R4016:Tex14 UTSW 11 87538623 unclassified probably null
R4089:Tex14 UTSW 11 87512203 missense probably damaging 1.00
R4158:Tex14 UTSW 11 87516769 missense probably benign 0.06
R4533:Tex14 UTSW 11 87536829 nonsense probably null
R4713:Tex14 UTSW 11 87536865 missense probably damaging 0.99
R4758:Tex14 UTSW 11 87514485 missense probably benign 0.00
R4880:Tex14 UTSW 11 87486295 missense possibly damaging 0.95
R5092:Tex14 UTSW 11 87514842 missense probably benign 0.03
R5119:Tex14 UTSW 11 87433813 missense probably damaging 1.00
R5322:Tex14 UTSW 11 87511472 missense probably benign 0.04
R5470:Tex14 UTSW 11 87551604 missense probably damaging 0.99
R5607:Tex14 UTSW 11 87522578 missense probably benign 0.00
R5642:Tex14 UTSW 11 87514220 missense probably benign
R5643:Tex14 UTSW 11 87535626 missense probably damaging 1.00
R5786:Tex14 UTSW 11 87514295 missense probably damaging 0.97
R6478:Tex14 UTSW 11 87514373 missense probably benign
R6560:Tex14 UTSW 11 87497862 missense possibly damaging 0.95
R6661:Tex14 UTSW 11 87495016 missense probably damaging 1.00
R7037:Tex14 UTSW 11 87497915 missense probably damaging 1.00
R7156:Tex14 UTSW 11 87484719 missense probably damaging 0.99
R7465:Tex14 UTSW 11 87514430 missense possibly damaging 0.48
R7675:Tex14 UTSW 11 87509678 missense probably damaging 1.00
R7725:Tex14 UTSW 11 87495042 missense probably damaging 0.99
R7911:Tex14 UTSW 11 87533602 critical splice donor site probably null
R7992:Tex14 UTSW 11 87533602 critical splice donor site probably null
RF018:Tex14 UTSW 11 87514746 missense probably benign 0.01
X0017:Tex14 UTSW 11 87535549 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGAAGACTGCCTTGAAAATACCAC -3'
(R):5'- GAAATGAGCTCTCCCTGCAAC -3'

Sequencing Primer
(F):5'- GACTGCCTTGAAAATACCACATTTC -3'
(R):5'- CTTCAAGAAGCAAAATGGAACTCTTC -3'
Posted On2016-04-27