Mutagenetix > Incidental Mutations

Incidental Mutation 'R0400:Tph2'

38144

Institutional Source

Beutler Lab

Gene Symbol

Tph2

Ensembl Gene

ENSMUSG00000006764

Gene Name

tryptophan hydroxylase 2

Synonyms

MMRRC Submission

038605-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.263) question?

Stock #

R0400 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115078641-115185022 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 115080120 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000006949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006949]

AlphaFold

Q8CGV2

Predicted Effect

probably benign
Transcript: ENSMUST00000006949

SMART Domains

Protein: ENSMUSP00000006949
Gene: ENSMUSG00000006764

Domain	Start	End	E-Value	Type
low complexity region	94	102	N/A	INTRINSIC
Pfam:Biopterin_H	150	480	3.6e-177	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.8%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mutations in this locus result in abnormal serotonin levels in the brain. Whether an increase or decrease in serotonin levels is seen depends on the specific nucleotide substitution/point mutation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	T	A	11: 30,426,360	H169L	probably benign	Het
9130230L23Rik	T	C	5: 65,990,356	D28G	unknown	Het
Abca12	T	A	1: 71,259,776		probably benign	Het
Acsl5	T	C	19: 55,293,711	V573A	probably damaging	Het
Agap1	A	G	1: 89,843,250		probably benign	Het
Arid2	A	G	15: 96,356,925		probably benign	Het
B430305J03Rik	T	A	3: 61,364,135		probably benign	Het
Brsk2	T	C	7: 141,998,553	L584P	probably damaging	Het
C2cd4c	A	G	10: 79,613,209	Y35H	probably damaging	Het
Cacul1	A	G	19: 60,563,153		probably benign	Het
Cers3	T	C	7: 66,764,330	V88A	probably benign	Het
Cnnm1	A	T	19: 43,468,364	H614L	probably damaging	Het
Col1a1	T	A	11: 94,941,369		probably benign	Het
Cyp1b1	T	A	17: 79,713,587	D242V	probably damaging	Het
Cyp4a31	T	C	4: 115,563,718	M1T	probably null	Het
Dbn1	C	T	13: 55,474,916	E585K	probably damaging	Het
Dclk2	A	T	3: 86,813,747		probably null	Het
Ddx58	A	G	4: 40,235,257	Y78H	probably benign	Het
Dnah17	A	G	11: 118,082,078	S2010P	probably damaging	Het
Dram2	T	C	3: 106,573,618	L246P	probably damaging	Het
Dus2	A	T	8: 106,048,677	T279S	probably benign	Het
Epn2	T	C	11: 61,532,696		probably null	Het
Esco2	C	A	14: 65,831,706	V52F	possibly damaging	Het
Fbp1	T	A	13: 62,865,068	T104S	probably benign	Het
Foxj2	A	T	6: 122,833,808	Q249L	possibly damaging	Het
Galnt7	T	C	8: 57,583,989	Y122C	probably damaging	Het
Gimd1	T	C	3: 132,634,827	Y35H	probably benign	Het
Gipc2	A	G	3: 152,165,668	F74L	probably damaging	Het
Glt1d1	T	A	5: 127,657,075		probably benign	Het
Hmcn2	A	G	2: 31,400,129	T2325A	probably damaging	Het
Iffo1	A	G	6: 125,153,471	K471R	probably damaging	Het
Ireb2	G	A	9: 54,896,498	R491H	probably benign	Het
Isg20	A	G	7: 78,916,725	N141D	possibly damaging	Het
Kmt5c	G	A	7: 4,746,244	R100H	probably benign	Het
Lrp1b	T	C	2: 40,750,914	D3506G	probably benign	Het
Lrrn4	A	C	2: 132,878,020	F287V	probably benign	Het
Mmrn1	A	C	6: 60,977,115	K793N	probably benign	Het
Muc16	A	G	9: 18,510,534	V8227A	possibly damaging	Het
Myh2	C	T	11: 67,192,598		probably benign	Het
Nalcn	T	A	14: 123,290,960		probably benign	Het
Nfia	T	C	4: 98,063,136	V400A	probably damaging	Het
Nxph4	T	A	10: 127,526,258	T255S	possibly damaging	Het
Olfm5	G	A	7: 104,154,179	T359I	probably damaging	Het
Olfr141	A	G	2: 86,806,651	M116T	probably damaging	Het
Olfr393	T	C	11: 73,848,041	Y28C	probably benign	Het
Olfr907	A	G	9: 38,498,911	M81V	possibly damaging	Het
Olfr935	G	T	9: 38,995,198	P79Q	probably damaging	Het
Pak7	T	C	2: 136,097,579	I545M	possibly damaging	Het
Pcdhb15	T	C	18: 37,475,895	F727L	probably benign	Het
Pds5b	T	A	5: 150,723,353	N202K	possibly damaging	Het
Phlpp1	T	A	1: 106,392,934	I1553N	probably benign	Het
Pink1	T	C	4: 138,317,918	T282A	probably damaging	Het
Prdm2	A	G	4: 143,111,670	F1706S	probably benign	Het
Pycr1	G	A	11: 120,641,526		probably benign	Het
Skint9	A	G	4: 112,414,001	S71P	probably damaging	Het
Smad1	A	G	8: 79,371,770		probably benign	Het
Snapc5	A	T	9: 64,180,507	E33D	probably damaging	Het
Snrnp40	T	C	4: 130,362,650	L56P	probably damaging	Het
Stab2	A	C	10: 86,872,610	I1697S	probably damaging	Het
Tfap2a	G	T	13: 40,717,412		probably benign	Het
Tmem57	T	C	4: 134,828,116	K349E	probably benign	Het
Triml1	A	G	8: 43,141,040	V118A	probably benign	Het
Ttbk2	T	A	2: 120,750,242	T538S	probably benign	Het
Ttn	A	G	2: 76,715,272	V32569A	possibly damaging	Het
U2af1	T	A	17: 31,648,192	Y158F	probably benign	Het
Usp7	A	T	16: 8,716,632		probably benign	Het
Vdr	A	G	15: 97,869,351	S179P	probably benign	Het
Vps13d	A	C	4: 145,065,827	S663A	probably benign	Het
Wdr62	T	A	7: 30,241,462	T844S	possibly damaging	Het
Wipi1	C	T	11: 109,577,130	R407Q	probably damaging	Het
Zbtb43	A	G	2: 33,453,897	C439R	probably damaging	Het
Zfp507	T	A	7: 35,791,746	H704L	probably damaging	Het
Zzef1	G	A	11: 72,895,242	R2080K	probably damaging	Het

Other mutations in Tph2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01469:Tph2	APN	10	115079759	nonsense	probably null
IGL01989:Tph2	APN	10	115146016	missense	probably benign	0.22
IGL02363:Tph2	APN	10	115079981	missense	probably benign	0.01
IGL02667:Tph2	APN	10	115080045	missense	probably benign	0.43
R0390:Tph2	UTSW	10	115174109	missense	probably damaging	1.00
R0570:Tph2	UTSW	10	115174134	splice site	probably benign
R1466:Tph2	UTSW	10	115079695	missense	probably benign
R1466:Tph2	UTSW	10	115079695	missense	probably benign
R1654:Tph2	UTSW	10	115184807	missense	probably benign
R3705:Tph2	UTSW	10	115119893	nonsense	probably null
R3710:Tph2	UTSW	10	115174058	missense	probably benign	0.42
R3777:Tph2	UTSW	10	115080005	missense	probably benign
R4794:Tph2	UTSW	10	115182770	missense	possibly damaging	0.84
R5015:Tph2	UTSW	10	115079716	missense	probably benign	0.01
R5068:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5069:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5070:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5422:Tph2	UTSW	10	115079764	missense	possibly damaging	0.94
R5487:Tph2	UTSW	10	115119874	missense	probably damaging	1.00
R5604:Tph2	UTSW	10	115090709	missense	probably damaging	1.00
R5692:Tph2	UTSW	10	115184827	missense	probably damaging	0.97
R6368:Tph2	UTSW	10	115179326	missense	probably damaging	1.00
R6802:Tph2	UTSW	10	115184873	missense	probably damaging	1.00
R6823:Tph2	UTSW	10	115174106	missense	probably benign	0.02
R7371:Tph2	UTSW	10	115151111	missense	probably damaging	1.00
R7724:Tph2	UTSW	10	115079822	missense	probably benign
R7863:Tph2	UTSW	10	115080001	missense	probably damaging	1.00
R8046:Tph2	UTSW	10	115179594	missense	possibly damaging	0.62
R8738:Tph2	UTSW	10	115179709	splice site	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAAGGGACGGGTAATTGACTTTGC -3'
(R):5'- TTCCATTTGTGTCATGGGAGAGAGC -3'

Sequencing Primer
(F):5'- TTGCAAAGTCCCTGTAGAATAAAC -3'
(R):5'- AACTGTCCTTTTGCATGAATTTGG -3'

Posted On

2013-05-23