Incidental Mutation 'R4954:Olfr628'
ID381486
Institutional Source Beutler Lab
Gene Symbol Olfr628
Ensembl Gene ENSMUSG00000096516
Gene Nameolfactory receptor 628
SynonymsGA_x6K02T2PBJ9-6457667-6458617, MOR22-4P, MOR22-4P, Olfr1526-ps1, MOR22-1
MMRRC Submission 042551-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4954 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103730374-103733324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103732207 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 94 (I94V)
Ref Sequence ENSEMBL: ENSMUSP00000151622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098193] [ENSMUST00000218266]
Predicted Effect probably damaging
Transcript: ENSMUST00000098193
AA Change: I94V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095795
Gene: ENSMUSG00000096516
AA Change: I94V

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 2.3e-106 PFAM
Pfam:7tm_1 43 295 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218266
AA Change: I94V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.256 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,911,434 H668Y probably benign Het
AI464131 G A 4: 41,498,241 A463V possibly damaging Het
Alk C T 17: 71,902,692 W919* probably null Het
Aoc3 G A 11: 101,332,099 G387D probably damaging Het
Arhgap26 T A 18: 39,243,641 C441S probably benign Het
Arhgap28 C A 17: 67,869,013 E100* probably null Het
Ate1 C T 7: 130,509,018 G186D probably benign Het
Birc6 T A 17: 74,612,031 L1948H probably damaging Het
Bmp2k C T 5: 97,086,764 probably benign Het
Ccin A T 4: 43,985,077 I495F probably benign Het
Cir1 T A 2: 73,310,504 E40D probably benign Het
Cyp3a57 A T 5: 145,370,955 probably null Het
Dennd1b A G 1: 139,053,386 T113A probably damaging Het
Dnah2 G A 11: 69,539,496 P79S possibly damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Enpep A T 3: 129,284,180 I596N probably damaging Het
Eps15 G A 4: 109,370,678 probably null Het
Ext1 T C 15: 53,344,492 D291G probably damaging Het
Gm12883 T C 4: 121,395,001 noncoding transcript Het
Gm7257 A T 9: 36,432,860 K46N probably benign Het
Gm9921 A G 12: 45,437,600 noncoding transcript Het
H2-T22 C A 17: 36,041,959 W85C probably damaging Het
Heatr1 G A 13: 12,407,516 probably null Het
Hspa4l T A 3: 40,785,400 probably null Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Kpna1 T C 16: 36,033,326 V442A probably damaging Het
Mogat2 T C 7: 99,238,517 T17A possibly damaging Het
Musk C T 4: 58,344,222 T285I probably damaging Het
Nbea T G 3: 56,035,958 Q632P probably damaging Het
Ncoa3 T C 2: 166,065,786 V1105A probably benign Het
Neb T C 2: 52,177,518 probably null Het
Nlrp4e A T 7: 23,361,893 K970* probably null Het
Olfr309 T C 7: 86,306,601 I171V probably benign Het
Olfr47 A G 6: 43,236,384 M259V probably benign Het
Oog2 A T 4: 144,190,732 probably benign Het
Otos T C 1: 92,644,445 Y53C probably damaging Het
Oxct2a A T 4: 123,322,459 C376* probably null Het
Phf14 C A 6: 11,987,620 Q633K probably benign Het
Pkdrej T A 15: 85,816,401 N1778I probably damaging Het
Psmc3 C T 2: 91,055,629 probably benign Het
Rbm33 A T 5: 28,339,276 I177F probably damaging Het
Rps6ka2 A G 17: 7,271,604 D307G probably benign Het
Rps6ka2 G A 17: 7,299,286 V648I probably benign Het
Scn11a C T 9: 119,758,659 V1340M possibly damaging Het
Sema7a T C 9: 57,956,380 W279R probably damaging Het
Slc2a10 A T 2: 165,514,755 I112F probably damaging Het
Stk4 C A 2: 164,151,681 S77R possibly damaging Het
Stk4 T A 2: 164,151,682 W78R probably damaging Het
Syf2 T A 4: 134,934,972 L99* probably null Het
Tas2r104 A T 6: 131,685,005 I247K probably damaging Het
Usp15 G T 10: 123,131,398 R368S probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r2 T A 3: 64,140,484 L20F probably benign Het
Wdr60 T C 12: 116,256,025 D99G probably damaging Het
Zcchc4 A T 5: 52,819,217 H451L probably damaging Het
Other mutations in Olfr628
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Olfr628 APN 7 103732480 missense possibly damaging 0.47
IGL02121:Olfr628 APN 7 103732469 missense probably damaging 1.00
R0140:Olfr628 UTSW 7 103732142 missense probably damaging 1.00
R0505:Olfr628 UTSW 7 103732376 missense probably benign 0.09
R0582:Olfr628 UTSW 7 103732673 missense possibly damaging 0.82
R1585:Olfr628 UTSW 7 103732378 missense possibly damaging 0.56
R1907:Olfr628 UTSW 7 103731983 missense probably damaging 1.00
R4766:Olfr628 UTSW 7 103732250 missense possibly damaging 0.70
R5464:Olfr628 UTSW 7 103732189 missense probably damaging 1.00
R6737:Olfr628 UTSW 7 103732150 missense probably damaging 1.00
R6761:Olfr628 UTSW 7 103732484 missense probably damaging 1.00
R6782:Olfr628 UTSW 7 103732342 missense possibly damaging 0.67
R7015:Olfr628 UTSW 7 103732817 missense probably null 0.85
R7503:Olfr628 UTSW 7 103732267 missense probably damaging 1.00
X0058:Olfr628 UTSW 7 103732282 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGACTGGGATTCCTGG -3'
(R):5'- CTACAAACAGGGCTGCTCTG -3'

Sequencing Primer
(F):5'- TCTGTATCATGTACATCATTGCAC -3'
(R):5'- GAGTGTGACTCCTACTCCTATTTGAG -3'
Posted On2016-04-27