Incidental Mutation 'R4954:Abcb5'
ID381498
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms9230106F14Rik
MMRRC Submission 042551-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R4954 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location118867824-118966421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118911434 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 668 (H668Y)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
Predicted Effect probably benign
Transcript: ENSMUST00000035515
AA Change: H668Y

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: H668Y

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100982
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI464131 G A 4: 41,498,241 A463V possibly damaging Het
Alk C T 17: 71,902,692 W919* probably null Het
Aoc3 G A 11: 101,332,099 G387D probably damaging Het
Arhgap26 T A 18: 39,243,641 C441S probably benign Het
Arhgap28 C A 17: 67,869,013 E100* probably null Het
Ate1 C T 7: 130,509,018 G186D probably benign Het
Birc6 T A 17: 74,612,031 L1948H probably damaging Het
Bmp2k C T 5: 97,086,764 probably benign Het
Ccin A T 4: 43,985,077 I495F probably benign Het
Cir1 T A 2: 73,310,504 E40D probably benign Het
Cyp3a57 A T 5: 145,370,955 probably null Het
Dennd1b A G 1: 139,053,386 T113A probably damaging Het
Dnah2 G A 11: 69,539,496 P79S possibly damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Enpep A T 3: 129,284,180 I596N probably damaging Het
Eps15 G A 4: 109,370,678 probably null Het
Ext1 T C 15: 53,344,492 D291G probably damaging Het
Gm12883 T C 4: 121,395,001 noncoding transcript Het
Gm7257 A T 9: 36,432,860 K46N probably benign Het
Gm9921 A G 12: 45,437,600 noncoding transcript Het
H2-T22 C A 17: 36,041,959 W85C probably damaging Het
Heatr1 G A 13: 12,407,516 probably null Het
Hspa4l T A 3: 40,785,400 probably null Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Kpna1 T C 16: 36,033,326 V442A probably damaging Het
Mogat2 T C 7: 99,238,517 T17A possibly damaging Het
Musk C T 4: 58,344,222 T285I probably damaging Het
Nbea T G 3: 56,035,958 Q632P probably damaging Het
Ncoa3 T C 2: 166,065,786 V1105A probably benign Het
Neb T C 2: 52,177,518 probably null Het
Nlrp4e A T 7: 23,361,893 K970* probably null Het
Olfr309 T C 7: 86,306,601 I171V probably benign Het
Olfr47 A G 6: 43,236,384 M259V probably benign Het
Olfr628 A G 7: 103,732,207 I94V probably damaging Het
Oog2 A T 4: 144,190,732 probably benign Het
Otos T C 1: 92,644,445 Y53C probably damaging Het
Oxct2a A T 4: 123,322,459 C376* probably null Het
Phf14 C A 6: 11,987,620 Q633K probably benign Het
Pkdrej T A 15: 85,816,401 N1778I probably damaging Het
Psmc3 C T 2: 91,055,629 probably benign Het
Rbm33 A T 5: 28,339,276 I177F probably damaging Het
Rps6ka2 A G 17: 7,271,604 D307G probably benign Het
Rps6ka2 G A 17: 7,299,286 V648I probably benign Het
Scn11a C T 9: 119,758,659 V1340M possibly damaging Het
Sema7a T C 9: 57,956,380 W279R probably damaging Het
Slc2a10 A T 2: 165,514,755 I112F probably damaging Het
Stk4 C A 2: 164,151,681 S77R possibly damaging Het
Stk4 T A 2: 164,151,682 W78R probably damaging Het
Syf2 T A 4: 134,934,972 L99* probably null Het
Tas2r104 A T 6: 131,685,005 I247K probably damaging Het
Usp15 G T 10: 123,131,398 R368S probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r2 T A 3: 64,140,484 L20F probably benign Het
Wdr60 T C 12: 116,256,025 D99G probably damaging Het
Zcchc4 A T 5: 52,819,217 H451L probably damaging Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118890610 missense probably benign 0.03
IGL00092:Abcb5 APN 12 118928695 missense probably benign 0.09
IGL00503:Abcb5 APN 12 118907601 missense probably benign 0.02
IGL00776:Abcb5 APN 12 118919854 missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118886176 missense probably benign
IGL01302:Abcb5 APN 12 118918200 missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118872867 missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118867970 missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118911434 missense probably benign 0.03
IGL01784:Abcb5 APN 12 118890664 missense probably benign 0.14
IGL01967:Abcb5 APN 12 118867972 missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118927358 missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118940680 missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118874755 missense probably benign
IGL02292:Abcb5 APN 12 118918197 missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118940678 missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118906268 splice site probably benign
IGL02685:Abcb5 APN 12 118905947 missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118890685 missense probably benign 0.05
IGL02876:Abcb5 APN 12 118919841 missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118944939 missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118940369 missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118936087 missense probably benign 0.43
IGL03200:Abcb5 APN 12 118965254 splice site probably benign
IGL03407:Abcb5 APN 12 118940376 missense probably benign 0.01
F5770:Abcb5 UTSW 12 118886179 missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118936098 missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118890687 missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118927394 missense probably benign
R0219:Abcb5 UTSW 12 118886150 splice site probably benign
R0312:Abcb5 UTSW 12 118872837 missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118965251 splice site probably benign
R0359:Abcb5 UTSW 12 118940332 missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118877810 missense probably benign 0.03
R0582:Abcb5 UTSW 12 118940412 missense probably benign 0.40
R0815:Abcb5 UTSW 12 118901449 splice site probably benign
R0900:Abcb5 UTSW 12 118940624 missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118906198 missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118932575 missense probably benign 0.36
R1125:Abcb5 UTSW 12 118911547 missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118874762 missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118965329 start gained probably benign
R1726:Abcb5 UTSW 12 118874801 splice site probably null
R1726:Abcb5 UTSW 12 118907532 missense possibly damaging 0.95
R1836:Abcb5 UTSW 12 118867961 missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118907500 splice site probably null
R1976:Abcb5 UTSW 12 118890682 missense probably benign
R2005:Abcb5 UTSW 12 118877827 missense probably benign 0.15
R2068:Abcb5 UTSW 12 118940568 nonsense probably null
R2181:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118867956 missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118872933 missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118874620 missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118901352 splice site probably null
R3919:Abcb5 UTSW 12 118890618 missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118868669 missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118872922 missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118932610 critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118965305 missense possibly damaging 0.95
R4966:Abcb5 UTSW 12 118886891 intron probably benign
R5169:Abcb5 UTSW 12 118877817 nonsense probably null
R5327:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R5333:Abcb5 UTSW 12 118867942 missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118867930 missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118887177 missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118911499 missense probably benign
R5416:Abcb5 UTSW 12 118907596 missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118927326 missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118940690 missense probably null 1.00
R5566:Abcb5 UTSW 12 118935967 missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118932613 splice site probably null
R5691:Abcb5 UTSW 12 118927235 missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118918257 missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118927404 missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118868781 nonsense probably null
R5994:Abcb5 UTSW 12 118965260 critical splice donor site probably null
R6295:Abcb5 UTSW 12 118874644 missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118890549 critical splice donor site probably null
R6609:Abcb5 UTSW 12 118928762 missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118944906 missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118901354 splice site probably null
R6870:Abcb5 UTSW 12 118965265 missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118911530 missense probably benign 0.06
R6957:Abcb5 UTSW 12 118907535 missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118927277 missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118931925 missense probably benign 0.00
R7061:Abcb5 UTSW 12 118877774 missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118867876 missense probably benign 0.00
R7239:Abcb5 UTSW 12 118928725 missense probably benign 0.19
R7267:Abcb5 UTSW 12 118952470 missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118911560 missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118867874 missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118918164 missense probably damaging 1.00
V7580:Abcb5 UTSW 12 118886179 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TTGTAGGAAGGAACAGCATGTTTTC -3'
(R):5'- CATGTACACTCTTCCTTTAAGGCAC -3'

Sequencing Primer
(F):5'- CTGCCCAACAGGACCTTTTTGAC -3'
(R):5'- GGCACTATTATGACAGCATGC -3'
Posted On2016-04-27