Incidental Mutation 'R4954:Heatr1'
ID381499
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene NameHEAT repeat containing 1
SynonymsB130016L12Rik
MMRRC Submission 042551-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4954 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location12395027-12440289 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to A at 12407516 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270] [ENSMUST00000221046]
Predicted Effect probably null
Transcript: ENSMUST00000059270
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221746
Meta Mutation Damage Score 0.9578 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,911,434 H668Y probably benign Het
AI464131 G A 4: 41,498,241 A463V possibly damaging Het
Alk C T 17: 71,902,692 W919* probably null Het
Aoc3 G A 11: 101,332,099 G387D probably damaging Het
Arhgap26 T A 18: 39,243,641 C441S probably benign Het
Arhgap28 C A 17: 67,869,013 E100* probably null Het
Ate1 C T 7: 130,509,018 G186D probably benign Het
Birc6 T A 17: 74,612,031 L1948H probably damaging Het
Bmp2k C T 5: 97,086,764 probably benign Het
Ccin A T 4: 43,985,077 I495F probably benign Het
Cir1 T A 2: 73,310,504 E40D probably benign Het
Cyp3a57 A T 5: 145,370,955 probably null Het
Dennd1b A G 1: 139,053,386 T113A probably damaging Het
Dnah2 G A 11: 69,539,496 P79S possibly damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Enpep A T 3: 129,284,180 I596N probably damaging Het
Eps15 G A 4: 109,370,678 probably null Het
Ext1 T C 15: 53,344,492 D291G probably damaging Het
Gm12883 T C 4: 121,395,001 noncoding transcript Het
Gm7257 A T 9: 36,432,860 K46N probably benign Het
Gm9921 A G 12: 45,437,600 noncoding transcript Het
H2-T22 C A 17: 36,041,959 W85C probably damaging Het
Hspa4l T A 3: 40,785,400 probably null Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Kpna1 T C 16: 36,033,326 V442A probably damaging Het
Mogat2 T C 7: 99,238,517 T17A possibly damaging Het
Musk C T 4: 58,344,222 T285I probably damaging Het
Nbea T G 3: 56,035,958 Q632P probably damaging Het
Ncoa3 T C 2: 166,065,786 V1105A probably benign Het
Neb T C 2: 52,177,518 probably null Het
Nlrp4e A T 7: 23,361,893 K970* probably null Het
Olfr309 T C 7: 86,306,601 I171V probably benign Het
Olfr47 A G 6: 43,236,384 M259V probably benign Het
Olfr628 A G 7: 103,732,207 I94V probably damaging Het
Oog2 A T 4: 144,190,732 probably benign Het
Otos T C 1: 92,644,445 Y53C probably damaging Het
Oxct2a A T 4: 123,322,459 C376* probably null Het
Phf14 C A 6: 11,987,620 Q633K probably benign Het
Pkdrej T A 15: 85,816,401 N1778I probably damaging Het
Psmc3 C T 2: 91,055,629 probably benign Het
Rbm33 A T 5: 28,339,276 I177F probably damaging Het
Rps6ka2 A G 17: 7,271,604 D307G probably benign Het
Rps6ka2 G A 17: 7,299,286 V648I probably benign Het
Scn11a C T 9: 119,758,659 V1340M possibly damaging Het
Sema7a T C 9: 57,956,380 W279R probably damaging Het
Slc2a10 A T 2: 165,514,755 I112F probably damaging Het
Stk4 C A 2: 164,151,681 S77R possibly damaging Het
Stk4 T A 2: 164,151,682 W78R probably damaging Het
Syf2 T A 4: 134,934,972 L99* probably null Het
Tas2r104 A T 6: 131,685,005 I247K probably damaging Het
Usp15 G T 10: 123,131,398 R368S probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r2 T A 3: 64,140,484 L20F probably benign Het
Wdr60 T C 12: 116,256,025 D99G probably damaging Het
Zcchc4 A T 5: 52,819,217 H451L probably damaging Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12406037 missense probably benign 0.14
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2119:Heatr1 UTSW 13 12432646 missense probably null 1.00
R2121:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12435121 missense probably benign 0.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4797:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5483:Heatr1 UTSW 13 12398914 missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12406619 missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5836:Heatr1 UTSW 13 12408736 missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R6922:Heatr1 UTSW 13 12435075 missense probably benign 0.00
R7077:Heatr1 UTSW 13 12418164 missense possibly damaging 0.63
R7297:Heatr1 UTSW 13 12421060 nonsense probably null
R7445:Heatr1 UTSW 13 12431038 missense possibly damaging 0.70
R7669:Heatr1 UTSW 13 12411262 missense probably benign 0.33
R7672:Heatr1 UTSW 13 12438664 missense probably damaging 0.96
R7772:Heatr1 UTSW 13 12417641 missense probably benign 0.03
RF011:Heatr1 UTSW 13 12407544 missense probably benign 0.00
Z1176:Heatr1 UTSW 13 12399008 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CAACATGTATGTCTTCCTGTGTTTTAA -3'
(R):5'- AAGGCAGATATTCCAAAGAAACTAAA -3'

Sequencing Primer
(F):5'- AACTCATGCGTGTTGGCTAAG -3'
(R):5'- GCTGTTGGCACAAACCT -3'
Posted On2016-04-27