Incidental Mutation 'R4955:Dusp27'
ID381515
Institutional Source Beutler Lab
Gene Symbol Dusp27
Ensembl Gene ENSMUSG00000026564
Gene Namedual specificity phosphatase 27 (putative)
SynonymsC130085G02Rik
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4955 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location166098148-166127922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 166108092 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 179 (Y179C)
Ref Sequence ENSEMBL: ENSMUSP00000141564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
Predicted Effect probably damaging
Transcript: ENSMUST00000085992
AA Change: Y179C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: Y179C

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192369
AA Change: Y179C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: Y179C

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Meta Mutation Damage Score 0.8138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4933407L21Rik T A 1: 85,931,287 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arl2bp G A 8: 94,670,428 probably null Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Fstl5 T A 3: 76,223,876 probably null Het
Hist1h4i T A 13: 22,041,185 I47F probably damaging Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Ing4 C T 6: 125,048,201 A225V probably damaging Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Lrfn5 A C 12: 61,839,978 D184A probably benign Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Nqo1 A G 8: 107,388,857 S263P probably benign Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Opn5 A T 17: 42,611,238 F24L probably damaging Het
Palmd A G 3: 116,924,224 V208A probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Rcan2 C A 17: 44,037,081 P13Q probably damaging Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Zfp341 T C 2: 154,638,030 V467A probably damaging Het
Other mutations in Dusp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Dusp27 APN 1 166100552 missense probably benign 0.00
IGL00973:Dusp27 APN 1 166099458 missense probably benign
IGL01331:Dusp27 APN 1 166108180 missense probably damaging 1.00
IGL01466:Dusp27 APN 1 166100504 missense probably damaging 1.00
IGL01572:Dusp27 APN 1 166100372 missense probably benign 0.18
IGL01906:Dusp27 APN 1 166099523 missense probably damaging 1.00
IGL01974:Dusp27 APN 1 166100536 nonsense probably null
IGL02112:Dusp27 APN 1 166099671 nonsense probably null
IGL02805:Dusp27 APN 1 166099061 missense probably damaging 1.00
IGL03343:Dusp27 APN 1 166099448 missense probably benign 0.00
R0116:Dusp27 UTSW 1 166099701 missense probably benign 0.19
R0367:Dusp27 UTSW 1 166100763 missense probably benign 0.05
R0499:Dusp27 UTSW 1 166099101 missense probably benign 0.00
R0542:Dusp27 UTSW 1 166101284 missense possibly damaging 0.90
R1312:Dusp27 UTSW 1 166099291 missense possibly damaging 0.46
R1572:Dusp27 UTSW 1 166099455 missense possibly damaging 0.68
R1598:Dusp27 UTSW 1 166110259 missense probably benign 0.10
R1858:Dusp27 UTSW 1 166100846 missense possibly damaging 0.87
R2021:Dusp27 UTSW 1 166100823 missense probably benign 0.00
R2970:Dusp27 UTSW 1 166099229 missense probably benign 0.04
R3727:Dusp27 UTSW 1 166099506 missense probably damaging 1.00
R4041:Dusp27 UTSW 1 166100111 missense probably benign 0.01
R4245:Dusp27 UTSW 1 166101116 missense probably damaging 1.00
R4967:Dusp27 UTSW 1 166127106 missense probably damaging 1.00
R5040:Dusp27 UTSW 1 166100345 missense probably benign 0.17
R5342:Dusp27 UTSW 1 166110250 missense probably benign 0.01
R5467:Dusp27 UTSW 1 166112030 critical splice donor site probably null
R5742:Dusp27 UTSW 1 166099454 missense probably benign 0.00
R6222:Dusp27 UTSW 1 166098645 missense probably benign 0.26
R6239:Dusp27 UTSW 1 166098819 missense probably damaging 1.00
R6531:Dusp27 UTSW 1 166110046 splice site probably null
R6586:Dusp27 UTSW 1 166100885 missense possibly damaging 0.79
R6958:Dusp27 UTSW 1 166107996 missense probably damaging 1.00
R7006:Dusp27 UTSW 1 166099094 missense probably benign
R7111:Dusp27 UTSW 1 166127154 missense possibly damaging 0.66
R7310:Dusp27 UTSW 1 166098731 missense possibly damaging 0.46
R7312:Dusp27 UTSW 1 166127107 missense probably damaging 0.99
R7378:Dusp27 UTSW 1 166112063 nonsense probably null
R7398:Dusp27 UTSW 1 166100475 missense probably damaging 1.00
R7442:Dusp27 UTSW 1 166101015 missense probably benign 0.01
R7569:Dusp27 UTSW 1 166108035 missense probably damaging 1.00
Z1088:Dusp27 UTSW 1 166099283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGACAGACATCCCTGCC -3'
(R):5'- TAAAGGTGTTAACTGTGAGCCC -3'

Sequencing Primer
(F):5'- GGAAGTTTTTATAACATTCCCCCAC -3'
(R):5'- AGACCTAGCCCAGCTATGTG -3'
Posted On2016-04-27