Incidental Mutation 'R4955:Zfp341'
ID381518
Institutional Source Beutler Lab
Gene Symbol Zfp341
Ensembl Gene ENSMUSG00000059842
Gene Namezinc finger protein 341
Synonyms
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4955 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154613297-154646821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154638030 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 467 (V467A)
Ref Sequence ENSEMBL: ENSMUSP00000105324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081926] [ENSMUST00000109702] [ENSMUST00000126421]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081926
AA Change: V474A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080596
Gene: ENSMUSG00000059842
AA Change: V474A

DomainStartEndE-ValueType
ZnF_C2H2 53 73 4.16e1 SMART
low complexity region 96 110 N/A INTRINSIC
low complexity region 154 161 N/A INTRINSIC
low complexity region 177 200 N/A INTRINSIC
ZnF_C2H2 320 342 3.69e-4 SMART
ZnF_C2H2 348 370 1.04e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 470 494 2.17e-1 SMART
ZnF_C2H2 500 522 2.91e-2 SMART
ZnF_C2H2 537 561 1.23e0 SMART
ZnF_C2H2 563 585 3.58e-2 SMART
ZnF_C2H2 591 613 1.62e0 SMART
ZnF_C2H2 619 641 2.27e-4 SMART
ZnF_C2H2 647 674 7.29e0 SMART
ZnF_C2H2 680 702 5.14e-3 SMART
low complexity region 740 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109702
AA Change: V467A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105324
Gene: ENSMUSG00000059842
AA Change: V467A

DomainStartEndE-ValueType
ZnF_C2H2 53 73 4.16e1 SMART
low complexity region 96 110 N/A INTRINSIC
low complexity region 154 161 N/A INTRINSIC
low complexity region 177 200 N/A INTRINSIC
ZnF_C2H2 313 335 3.69e-4 SMART
ZnF_C2H2 341 363 1.04e-3 SMART
ZnF_C2H2 435 457 1.45e-2 SMART
ZnF_C2H2 463 487 2.17e-1 SMART
ZnF_C2H2 493 515 2.91e-2 SMART
ZnF_C2H2 530 554 1.23e0 SMART
ZnF_C2H2 556 578 3.58e-2 SMART
ZnF_C2H2 584 606 1.62e0 SMART
ZnF_C2H2 612 634 2.27e-4 SMART
ZnF_C2H2 640 667 7.29e0 SMART
ZnF_C2H2 673 695 5.14e-3 SMART
low complexity region 733 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126421
Meta Mutation Damage Score 0.1466 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4933407L21Rik T A 1: 85,931,287 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arl2bp G A 8: 94,670,428 probably null Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Dusp27 T C 1: 166,108,092 Y179C probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Fstl5 T A 3: 76,223,876 probably null Het
Hist1h4i T A 13: 22,041,185 I47F probably damaging Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Ing4 C T 6: 125,048,201 A225V probably damaging Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Lrfn5 A C 12: 61,839,978 D184A probably benign Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Nqo1 A G 8: 107,388,857 S263P probably benign Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Opn5 A T 17: 42,611,238 F24L probably damaging Het
Palmd A G 3: 116,924,224 V208A probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Rcan2 C A 17: 44,037,081 P13Q probably damaging Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Other mutations in Zfp341
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp341 APN 2 154634231 missense probably damaging 1.00
IGL01352:Zfp341 APN 2 154628896 missense probably benign 0.00
IGL01748:Zfp341 APN 2 154628927 missense probably damaging 0.99
IGL02260:Zfp341 APN 2 154642049 missense possibly damaging 0.89
IGL02329:Zfp341 APN 2 154632304 missense possibly damaging 0.90
casanova_grimbacher UTSW 2 154624881 missense probably damaging 1.00
Specious UTSW 2 154646134 missense possibly damaging 0.63
R0079:Zfp341 UTSW 2 154624994 nonsense probably null
R0570:Zfp341 UTSW 2 154646068 missense probably benign 0.02
R0620:Zfp341 UTSW 2 154634273 missense possibly damaging 0.94
R1018:Zfp341 UTSW 2 154646052 missense probably damaging 1.00
R1611:Zfp341 UTSW 2 154645703 missense probably damaging 1.00
R1733:Zfp341 UTSW 2 154641378 missense probably benign 0.19
R1822:Zfp341 UTSW 2 154646134 missense possibly damaging 0.63
R1956:Zfp341 UTSW 2 154638212 missense probably benign 0.09
R2437:Zfp341 UTSW 2 154628801 missense probably damaging 0.97
R3623:Zfp341 UTSW 2 154624881 missense probably damaging 1.00
R4417:Zfp341 UTSW 2 154628987 missense possibly damaging 0.94
R4806:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4807:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4863:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4962:Zfp341 UTSW 2 154626814 missense possibly damaging 0.80
R5484:Zfp341 UTSW 2 154625001 missense probably benign 0.00
R5864:Zfp341 UTSW 2 154643554 missense possibly damaging 0.95
R5877:Zfp341 UTSW 2 154632289 missense probably damaging 1.00
R5975:Zfp341 UTSW 2 154630441 missense probably damaging 1.00
R5990:Zfp341 UTSW 2 154645659 missense probably damaging 0.98
R6057:Zfp341 UTSW 2 154625034 missense probably benign 0.01
R6882:Zfp341 UTSW 2 154638023 missense probably damaging 1.00
R7686:Zfp341 UTSW 2 154624861 missense probably damaging 0.96
R7701:Zfp341 UTSW 2 154634080 splice site probably null
R7847:Zfp341 UTSW 2 154634194 missense probably damaging 1.00
R7930:Zfp341 UTSW 2 154634194 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGCTTGCCCAGTATTTG -3'
(R):5'- AGACTCCTGAGCATCTGAGC -3'

Sequencing Primer
(F):5'- CCAGTATTTGGGAGGCTCTG -3'
(R):5'- ACATACTTGTAGACGGTGCTGTCC -3'
Posted On2016-04-27